header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070523-1
Morpholino Name: MO1-zic5
Target: zic5 (1)
Previous Name: 5MOC (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGCTTCTCACCTGTCAAATGTAAAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: intron 1/exon 2 splice-blocker
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-zic5 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-zic5 No data available
PHENOTYPE
Phenotype resulting from MO1-zic5
Phenotype of all Fish created by or utilizing MO1-zic5
Phenotype Fish Conditions Figures
fourth ventricle malformed, abnormal WT + MO1-zic5 standard conditions text only from Nyholm et al., 2007
tectal ventricle malformed, abnormal WT + MO1-zic5 standard conditions text only from Nyholm et al., 2007
cell proliferation in midbrain disrupted, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 9 with image from Nyholm et al., 2007
actin-myosin filament sliding decreased rate, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 3 from Nyholm et al., 2009
secondary neural tube formation process quality, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 2 from Nyholm et al., 2009
tectal ventricle malformed, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 2 from Nyholm et al., 2009
Fig. 7 with imageFig. 8 with image from Nyholm et al., 2007
regulation of mitotic cell cycle, embryonic process quality, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 6 from Nyholm et al., 2009
alar plate midbrain region physical object quality, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 3 from Nyholm et al., 2009
alar plate midbrain region apical junction complex patchy, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 4 from Nyholm et al., 2009
tectal ventricle decreased size, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 2 from Nyholm et al., 2009
midbrain development process quality, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 2Fig. 6 from Nyholm et al., 2009
hindbrain malformed, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 7 with imageFig. 8 with image from Nyholm et al., 2007
midbrain malformed, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 2Fig. 6 from Nyholm et al., 2009
Fig. 7 with imageFig. 8 with image from Nyholm et al., 2007
OTHER MO1-zic5 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)