header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070519-1
Morpholino Name: MO1-rap1aa
Target: rap1aa (1)
Previous Name: MO1-rap1a

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGGTGGCAGATTATTTCTTTTCACC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-rap1aa No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-rap1aa No data available
PHENOTYPE
Phenotype resulting from MO1-rap1aa
Phenotype of all Fish created by or utilizing MO1-rap1aa
Phenotype Fish Conditions Figures
whole organism increased curvature, abnormal WT + MO1-rap1aa standard conditions text only from Tsai et al., 2007
whole organism decreased length, abnormal WT + MO1-rap1aa standard conditions text only from Tsai et al., 2007
cardiac muscle adherens junction decreased amount, abnormal TU + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 3 with image from Dong et al., 2012
trunk increased curvature, abnormal TU + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 1 with image from Dong et al., 2012
pericardium edematous, abnormal TU + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 1 with image from Dong et al., 2012
cardiac muscle gap junction decreased amount, abnormal TU + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 3 with image from Dong et al., 2012
caudal fin blistered, abnormal TU + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 1 with image from Dong et al., 2012
cardiac conduction disrupted, abnormal TU + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 4 with image from Dong et al., 2012
cardiac muscle cardiac myofibril morphology, abnormal TU + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 3 with image from Dong et al., 2012
cardiac muscle sarcomere morphology, abnormal TU + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 3 with image from Dong et al., 2012
cardiac muscle striated muscle thin filament decreased amount, abnormal TU + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 3 with image from Dong et al., 2012
ceratohyal cartilage increased width, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. 6 from Bögershausen et al., 2015
eye decreased size, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. 2 from Bögershausen et al., 2015
chondrocyte myosin II filament position, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. S4 from Bögershausen et al., 2015
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. 2 from Bögershausen et al., 2015
ceratohyal cartilage chondrocyte disorganized, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. S4 from Bögershausen et al., 2015
Meckel's cartilage decreased distance ceratohyal cartilage, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. 6 from Bögershausen et al., 2015
ceratohyal cartilage kinked, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. 6 from Bögershausen et al., 2015
chondrocyte filamentous actin position, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. S4 from Bögershausen et al., 2015
ceratohyal cartilage shortened, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. 6 from Bögershausen et al., 2015
head decreased size, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. 2 from Bögershausen et al., 2015
whole organism decreased length, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. 2 from Bögershausen et al., 2015
MAP kinase kinase activity process quality, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. 10 from Bögershausen et al., 2015
somite increased width, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. 2 from Bögershausen et al., 2015
convergent extension disrupted, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. 10 from Bögershausen et al., 2015
convergent extension disrupted, abnormal WT + MO1-rap1aa + MO1-rap1b + MO5-kmt2d standard conditions Fig. 7 from Bögershausen et al., 2015
heart looping disrupted, abnormal pku5Et + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 1 with image from Dong et al., 2012
pericardium edematous, abnormal pku5Et + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 1 with image from Dong et al., 2012
heart malformed, abnormal pku5Et + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 1 with image from Dong et al., 2012
heart development disrupted, abnormal pku5Et + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 1 with imageFig. 2 with image from Dong et al., 2012
heart looping disrupted, abnormal pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. S2 with image from Dong et al., 2012
cardiac ventricle decreased size, abnormal pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions text only from Dong et al., 2012
heart development disrupted, abnormal pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 2 with image from Dong et al., 2012
heart dilated, abnormal pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions text only from Dong et al., 2012
heart morphology, abnormal pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. S2 with image from Dong et al., 2012
pericardium edematous, abnormal pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions text only from Dong et al., 2012
OTHER MO1-rap1aa MORPHOLINO PAGESNo links to external sites
CITATIONS (3)