header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070507-4
Morpholino Name: MO4-atoh1a
Target: atoh1a (1)
Previous Name: atoh1a MO3 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ATCCATTCTGTTGGTTTGTGCTTTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-atoh1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-atoh1a
Expressed Gene Anatomy Figures
atoh1a Fig. 5 from Go et al., 2010
Fig. 3 with image from Lecaudey et al., 2008
Fig. 3 with image from Millimaki et al., 2007
atoh1b Fig. 3 with image from Millimaki et al., 2007
atp2b1a Fig. 5 from Go et al., 2010
dla Fig. S8 from Nechiporuk et al., 2008
Fig. 4 with image from Millimaki et al., 2007
etv4 Fig. S8 from Nechiporuk et al., 2008
eya2 Fig. 5 from Wang et al., 2015
fgf10a Fig. S1 with image from Wang et al., 2018
Fig. S8 from Nechiporuk et al., 2008
neurod1 Fig. 3 from Wang et al., 2015
tlx2 Fig. 5 from Wang et al., 2015
PHENOTYPE
Phenotype resulting from MO4-atoh1a
Phenotype of all Fish created by or utilizing MO4-atoh1a
Phenotype Fish Conditions Figures
hair cell decreased amount, abnormal AB + MO4-atoh1a standard conditions Fig. 2 with image from Millimaki et al., 2007
neuromast absent, abnormal AB + MO4-atoh1a standard conditions Fig. 2 with image from Millimaki et al., 2007
statoacoustic (VIII) ganglion anatomical region decreased size, abnormal TU + MO4-atoh1a standard conditions Fig. 3Fig. 5 from Wang et al., 2015
posterior lateral line neuromast decreased amount, abnormal WT + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
posterior lateral line primordium GFP expression decreased amount, abnormal sk89Tg + MO4-atoh1a standard conditions Fig. 2 with image from Wang et al., 2018
posterior lateral line primordium GFP expression decreased amount, abnormal sk90Tg + MO4-atoh1a standard conditions Fig. 2 with image from Wang et al., 2018
posterior lateral line neuromast neuromast hair cell absent, abnormal zf106Tg + MO4-atoh1a standard conditions Fig. 3 with image from Lecaudey et al., 2008
posterior lateral line neuromast decreased amount, abnormal zf106Tg + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
neuromast hair cell kinocilium absent, abnormal zf106Tg + MO4-atoh1a standard conditions Fig. 3 with image from Lecaudey et al., 2008
hair cell absent, abnormal AB + MO1-atoh1b + MO4-atoh1a standard conditions Fig. 2 with image from Millimaki et al., 2007
statoacoustic (VIII) ganglion anatomical region decreased size, abnormal TU + MO1-sox9a + MO4-atoh1a standard conditions Fig. 5 from Wang et al., 2015
hair cell absent, abnormal mib1ta52b/ta52b + MO1-atoh1b + MO4-atoh1a standard conditions Fig. 4 with image from Millimaki et al., 2007
neuromast fgf10a expression absent, abnormal fgf3t24149/+ ; zf106Tg + MO4-atoh1a standard conditions Fig. S1 with image from Wang et al., 2018
neuromast fgf10a expression absent, abnormal fgf3t24149/t24149; zf106Tg + MO4-atoh1a standard conditions Fig. S1 with image from Wang et al., 2018
posterior lateral line neuromast decreased amount, abnormal fgf3t24149/t24149; zf106Tg + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
posterior lateral line primordium EGFP expression decreased amount, abnormal fgfr1at2227/t2227 ; sk85Tg ; sk89Tg + MO4-atoh1a standard conditions Fig. 4 with image from Wang et al., 2018
posterior lateral line primordium EGFP expression decreased amount, abnormal anos1ask51/+ ; anos1ask50/+ ; sk89Tg ; anos1bsk52/+ ; anos1bsk53/+ ; sk85Tg + MO4-atoh1a standard conditions Fig. 4 with image from Wang et al., 2018
posterior lateral line neuromast decreased amount, exacerbated anos1bsk53/+ ; anos1bsk52/+ ; anos1ask50/+ ; anos1ask51/+ + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
posterior lateral line neuromast decreased amount, abnormal anos1bsk53/+ ; anos1bsk52/+ ; anos1ask50/+ ; anos1ask51/+ + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
posterior lateral line neuromast decreased amount, abnormal zf106Tg ; anos1bsk53/+ ; anos1ask50/+ ; anos1ask51/+ ; anos1bsk52/+ + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
posterior lateral line neuromast decreased amount, abnormal anos1bsk52/+ ; anos1ask51/+ ; anos1ask50/+ ; zf106Tg ; fgf3t24149/t24149 ; anos1bsk53/+ + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
posterior lateral line neuromast decreased amount, abnormal fgf3t24149/t24149 ; anos1bsk52/+ ; anos1ask51/+ ; anos1bsk53/+ ; anos1ask50/+ + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
Genome Resources:
CITATIONS (7)