Morpholino

MO4-atoh1a

ID
ZDB-MRPHLNO-070507-4
Name
MO4-atoh1a
Previous Names
  • atoh1a MO3 (1)
Target
Sequence
5' - ATCCATTCTGTTGGTTTGTGCTTTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
View all 3 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-atoh1a
Phenotype
Phenotype resulting from MO4-atoh1a
Phenotype of all Fish created by or utilizing MO4-atoh1a
Phenotype Fish Conditions Figures
hair cell decreased amount, abnormal AB + MO4-atoh1a standard conditions Fig. 2 with image from Millimaki et al., 2007
neuromast absent, abnormal AB + MO4-atoh1a standard conditions Fig. 2 with image from Millimaki et al., 2007
statoacoustic (VIII) ganglion anatomical region decreased size, abnormal TU + MO4-atoh1a standard conditions Fig. 3Fig. 5 from Wang et al., 2015
posterior lateral line neuromast decreased amount, abnormal WT + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
posterior lateral line primordium GFP expression decreased amount, abnormal sk89Tg + MO4-atoh1a standard conditions Fig. 2 with image from Wang et al., 2018
posterior lateral line primordium GFP expression decreased amount, abnormal sk90Tg + MO4-atoh1a standard conditions Fig. 2 with image from Wang et al., 2018
posterior lateral line neuromast neuromast hair cell absent, abnormal zf106Tg + MO4-atoh1a standard conditions Fig. 3 with image from Lecaudey et al., 2008
posterior lateral line neuromast decreased amount, abnormal zf106Tg + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
neuromast hair cell kinocilium absent, abnormal zf106Tg + MO4-atoh1a standard conditions Fig. 3 with image from Lecaudey et al., 2008
hair cell absent, abnormal AB + MO1-atoh1b + MO4-atoh1a standard conditions Fig. 2 with image from Millimaki et al., 2007
statoacoustic (VIII) ganglion anatomical region decreased size, abnormal TU + MO1-sox9a + MO4-atoh1a standard conditions Fig. 5 from Wang et al., 2015
hair cell absent, abnormal mib1ta52b/ta52b + MO1-atoh1b + MO4-atoh1a standard conditions Fig. 4 with image from Millimaki et al., 2007
neuromast fgf10a expression absent, abnormal fgf3t24149/+ ; zf106Tg + MO4-atoh1a standard conditions Fig. S1 with image from Wang et al., 2018
neuromast fgf10a expression absent, abnormal fgf3t24149/t24149; zf106Tg + MO4-atoh1a standard conditions Fig. S1 with image from Wang et al., 2018
posterior lateral line neuromast decreased amount, abnormal fgf3t24149/t24149; zf106Tg + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
posterior lateral line primordium EGFP expression decreased amount, abnormal fgfr1at2227/t2227 ; sk85Tg ; sk89Tg + MO4-atoh1a standard conditions Fig. 4 with image from Wang et al., 2018
posterior lateral line primordium EGFP expression decreased amount, abnormal anos1ask51/+ ; anos1ask50/+ ; sk89Tg ; anos1bsk52/+ ; anos1bsk53/+ ; sk85Tg + MO4-atoh1a standard conditions Fig. 4 with image from Wang et al., 2018
posterior lateral line neuromast decreased amount, exacerbated anos1bsk53/+ ; anos1bsk52/+ ; anos1ask50/+ ; anos1ask51/+ + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
posterior lateral line neuromast decreased amount, abnormal anos1bsk53/+ ; anos1bsk52/+ ; anos1ask50/+ ; anos1ask51/+ + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
posterior lateral line neuromast decreased amount, abnormal zf106Tg ; anos1bsk53/+ ; anos1ask50/+ ; anos1ask51/+ ; anos1bsk52/+ + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
posterior lateral line neuromast decreased amount, abnormal anos1bsk52/+ ; anos1ask51/+ ; anos1ask50/+ ; zf106Tg ; fgf3t24149/t24149 ; anos1bsk53/+ + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
posterior lateral line neuromast decreased amount, abnormal fgf3t24149/t24149 ; anos1bsk52/+ ; anos1ask51/+ ; anos1bsk53/+ ; anos1ask50/+ + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
Citations