ZFIN ID: ZDB-MRPHLNO-070426-3
Morpholino Name: MO1-cdh23
Target: cdh23 (1)
Sequence:
5' - CTCCCGAACCTTCACACCACGACAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-cdh23 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-cdh23
Expressed Gene Anatomy Figures
nphs1 podocyte Fig. 2 from Gorski et al., 2015
pax2a pronephric glomerulus, pronephric tubule Fig. 2 from Gorski et al., 2015
PHENOTYPE 
Phenotype resulting from MO1-cdh23
Phenotype Figures
afferent neuron has extra parts of type afferent neuron neuron projection, abnormal Fig. S2 with image from Faucherre et al., 2010
afferent neuron neuron projection complexity, abnormal Fig. S2 with image from Faucherre et al., 2010
afferent neuron neuron projection transient, abnormal Fig. S2 with image from Faucherre et al., 2010
afferent neuron neuron projection development process quality, abnormal Fig. S2 with image from Faucherre et al., 2010

Phenotype of all Fish created by or utilizing MO1-cdh23
Phenotype Fish Conditions Figures
eye edematous, abnormal WT + MO1-cdh23 chemical treatment: gentamycin C1 Fig. 2 from Gorski et al., 2015
afferent neuron neuron projection development process quality, abnormal WT + MO1-cdh23 standard conditions Fig. S2 with image from Faucherre et al., 2010
pericardium edematous, abnormal WT + MO1-cdh23 chemical treatment: gentamycin C1 Fig. 2 from Gorski et al., 2015
afferent neuron neuron projection transient, abnormal WT + MO1-cdh23 standard conditions Fig. S2 with image from Faucherre et al., 2010
afferent neuron has extra parts of type afferent neuron neuron projection, abnormal WT + MO1-cdh23 standard conditions Fig. S2 with image from Faucherre et al., 2010
afferent neuron neuron projection complexity, abnormal WT + MO1-cdh23 standard conditions Fig. S2 with image from Faucherre et al., 2010
intestine edematous, abnormal WT + MO1-cdh23 chemical treatment: gentamycin C1 Fig. 2 from Gorski et al., 2015
neuromast hair cell plasma membrane protruding, abnormal synj1tQ296X/tQ296X + MO1-cdh23 standard conditions Fig. 3 with image from Trapani et al., 2009
OTHER MO1-cdh23 MORPHOLINO PAGESNo links to external sites
CITATIONS (5)