ZFIN ID: ZDB-MRPHLNO-070424-2
Morpholino Name: MO2-prl
Target: prl (1)
Sequence:
5' - TATTTTCTTGCGTGAATCTGTGTGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-prl No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-prl No data available
PHENOTYPE
Phenotype resulting from MO2-prl
No data available

Phenotype of all Fish created by or utilizing MO2-prl
No data available
OTHER MO2-prl MORPHOLINO PAGESNo links to external sites
CITATIONS (2)