Morpholino

MO1-unc45b

ID
ZDB-MRPHLNO-070423-1
Name
MO1-unc45b
Previous Names
None
Target
Sequence
5' - ATCTCCAATTTCTCCCATCGTCATT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-unc45b
Expressed Gene Anatomy Figures
myf5 Fig. S1 from Wohlgemuth et al., 2007
myh6 Fig. S2 from Wohlgemuth et al., 2007
myh7 Fig. S2 from Wohlgemuth et al., 2007
myl7 Fig. S2 from Wohlgemuth et al., 2007
myod1 Fig. S1 from Wohlgemuth et al., 2007
Phenotype
Phenotype resulting from MO1-unc45b
Phenotype Fish Figures
basibranchial mislocalised ventrally, abnormal AB + MO1-unc45b Fig. 6 from Wohlgemuth et al., 2007
basibranchial structure, abnormal AB + MO1-unc45b Fig. 6 from Wohlgemuth et al., 2007
basihyal bone decreased length, abnormal AB + MO1-unc45b Fig. 6 from Wohlgemuth et al., 2007
basihyal bone mislocalised ventrally, abnormal AB + MO1-unc45b Fig. 6 from Wohlgemuth et al., 2007
blood circulation arrested, abnormal AB + MO1-unc45b text only from Wohlgemuth et al., 2007
cardiac ventricle non-functional, abnormal AB + MO1-unc45b text only from Wohlgemuth et al., 2007
ceratobranchial bone mislocalised ventrally, abnormal AB + MO1-unc45b Fig. 6 from Wohlgemuth et al., 2007
ceratobranchial bone structure, abnormal AB + MO1-unc45b Fig. 6 from Wohlgemuth et al., 2007
ceratohyal cartilage mislocalised ventrally, abnormal AB + MO1-unc45b Fig. 6 from Wohlgemuth et al., 2007
ceratohyal cartilage structure, abnormal AB + MO1-unc45b Fig. 6 from Wohlgemuth et al., 2007
heart structure, abnormal AB + MO1-unc45b Fig. 5,  Fig. S2 from Wohlgemuth et al., 2007
heart looping arrested, abnormal AB + MO1-unc45b Fig. S2 from Wohlgemuth et al., 2007
Meckel's cartilage decreased length, abnormal AB + MO1-unc45b Fig. 6 from Wohlgemuth et al., 2007
Meckel's cartilage displaced, abnormal AB + MO1-unc45b Fig. 6 from Wohlgemuth et al., 2007
palatoquadrate cartilage decreased length, abnormal AB + MO1-unc45b Fig. 6 from Wohlgemuth et al., 2007
palatoquadrate cartilage mislocalised, abnormal AB + MO1-unc45b Fig. 6 from Wohlgemuth et al., 2007
pericardium edematous, abnormal AB + MO1-unc45b Fig. 2,  Fig. 5 from Wohlgemuth et al., 2007
skeletal muscle cell sarcomere structure, abnormal AB + MO1-unc45b Fig. 3 from Wohlgemuth et al., 2007
trunk musculature structure, abnormal AB + MO1-unc45b Fig. 3,  Fig. 4 from Wohlgemuth et al., 2007
whole organism paralysed, abnormal AB + MO1-unc45b text only from Wohlgemuth et al., 2007
yolk edematous, abnormal AB + MO1-unc45b Fig. 5 from Wohlgemuth et al., 2007
Phenotype of all Fish created by or utilizing MO1-unc45b
Phenotype Fish Conditions Figures
heart looping arrested, abnormal AB + MO1-unc45b standard conditions Fig. S2 from Wohlgemuth et al., 2007
ceratobranchial bone mislocalised ventrally, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
trunk musculature structure, abnormal AB + MO1-unc45b standard conditions Fig. 3,  Fig. 4 from Wohlgemuth et al., 2007
whole organism paralysed, abnormal AB + MO1-unc45b standard conditions text only from Wohlgemuth et al., 2007
palatoquadrate cartilage decreased length, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
ceratobranchial bone structure, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
ceratohyal cartilage mislocalised ventrally, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
skeletal muscle cell sarcomere structure, abnormal AB + MO1-unc45b standard conditions Fig. 3 from Wohlgemuth et al., 2007
yolk edematous, abnormal AB + MO1-unc45b standard conditions Fig. 5 from Wohlgemuth et al., 2007
Meckel's cartilage decreased length, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
basibranchial mislocalised ventrally, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
heart structure, abnormal AB + MO1-unc45b standard conditions Fig. 5,  Fig. S2 from Wohlgemuth et al., 2007
Meckel's cartilage displaced, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
basihyal bone mislocalised ventrally, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
blood circulation arrested, abnormal AB + MO1-unc45b standard conditions text only from Wohlgemuth et al., 2007
ceratohyal cartilage structure, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
pericardium edematous, abnormal AB + MO1-unc45b standard conditions Fig. 2,  Fig. 5 from Wohlgemuth et al., 2007
basihyal bone decreased length, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
basibranchial structure, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
cardiac ventricle non-functional, abnormal AB + MO1-unc45b standard conditions text only from Wohlgemuth et al., 2007
palatoquadrate cartilage mislocalised, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.