header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070410-6
Morpholino Name: MO1-cyp26c1
Target: cyp26c1 (1)
Sequence:
5' - AAACTCGGTTATCCTCACCTTGCGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets exon-3–intron-3 junction.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-cyp26c1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-cyp26c1
Expressed Gene Anatomy Figures
egr2b Fig. S1 with image from Rydeen et al., 2014
en2a Fig. S1 with image from Rydeen et al., 2014
hoxb4a Fig. S1 with image from Rydeen et al., 2014
ins Fig. 3 with image from Kinkel et al., 2009
myh6 Fig. 2 with image from Rydeen et al., 2014
myh7 Fig. 2 with image from Rydeen et al., 2014
myl7 Fig. 2 with image from Rydeen et al., 2014
PHENOTYPE
Phenotype resulting from MO1-cyp26c1
No data available

Phenotype of all Fish created by or utilizing MO1-cyp26c1
Phenotype Fish Conditions Figures
heart edematous, abnormal cyp26a1rw716/rw716 + MO1-cyp26c1 standard conditions Fig. S2 with image from Rydeen et al., 2014
pancreas mislocalised anteriorly, abnormal cyp26a1rw716/rw716 + MO1-cyp26c1 standard conditions Fig. 3 with image from Kinkel et al., 2009
pancreas increased length, abnormal cyp26a1rw716/rw716 + MO1-cyp26c1 standard conditions Fig. 3 with image from Kinkel et al., 2009
pancreas development process quality, abnormal cyp26a1rw716/rw716 + MO1-cyp26c1 standard conditions Fig. 3 with image from Kinkel et al., 2009
hindbrain edematous, abnormal cyp26a1rw716/rw716 + MO1-cyp26c1 standard conditions Fig. S2 with image from Rydeen et al., 2014
rhombomere 4 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 6 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 2 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
whole organism mmp9 expression increased amount, abnormal WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 5 with image from Rydeen et al., 2016
whole organism fgf8a expression decreased amount, abnormal WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 4 with image from Rydeen et al., 2016
heart fgf8a expression decreased amount, abnormal WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 4 with image from Rydeen et al., 2016
heart mmp9 expression increased amount, abnormal WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 5 with image from Rydeen et al., 2016
hindbrain edematous, abnormal WT + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. S2 with image from Rydeen et al., 2014
atrium has fewer parts of type cardiac muscle cell, abnormal WT + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 2 with image from Rydeen et al., 2014
heart edematous, abnormal WT + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. S2 with image from Rydeen et al., 2014
pancreas mislocalised anteriorly, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 3 with image from Kinkel et al., 2009
vagal lobe distended, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 2 with image from Hernandez et al., 2007
pancreas development process quality, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 3 with image from Kinkel et al., 2009
pharyngeal endoderm condensed, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 2 with image from Hernandez et al., 2007
hindbrain wholly posterioralized, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 2 with imageFig. S4 with image from Hernandez et al., 2007
pancreas increased length, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 3 with image from Kinkel et al., 2009
rhombomere 4 increased size, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 2 with imageFig. S4 with image from Hernandez et al., 2007
hindbrain morphology, abnormal cyp26a1rw716/rw716 + MO1-cyp26c1 + MO1-dnd1 standard conditions Fig. 2 with image from Hernandez et al., 2007
rhombomere 4 increased size, abnormal cyp26a1rw716/rw716 + MO1-cyp26c1 + MO1-dnd1 standard conditions Fig. S4 with image from Hernandez et al., 2007
hindbrain wholly posterioralized, abnormal cyp26a1rw716/rw716 + MO1-cyp26c1 + MO1-dnd1 standard conditions Fig. S4 with image from Hernandez et al., 2007
rhombomere 4 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal fci3Tg/fci3Tg + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 6 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 2 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
ventricular myocardium cardiac muscle cell mislocalised, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 5 with image from Rydeen et al., 2016
cardiac ventricle has number of cardiac muscle cell, ameliorated f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 chemical treatment by environment: 3-(N-HYDROXYCARBOXAMIDO)-2-ISOBUTYLPROPANOYL-TRP-METHYLAMIDE Fig. 5 with image from Rydeen et al., 2016
whole organism myl7 expression decreased amount, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 1 with imageFig. 5 with image from Rydeen et al., 2016
cardiac ventricle decreased size, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac muscle cell external to heart, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis process quality, ameliorated f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 chemical treatment by environment: 3-(N-HYDROXYCARBOXAMIDO)-2-ISOBUTYLPROPANOYL-TRP-METHYLAMIDE Fig. 5 with image from Rydeen et al., 2016
whole organism myh7 expression decreased amount, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
cell migration involved in heart formation process quality, abnormal fb7Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 2 with image from Rydeen et al., 2016
cardiac ventricle cell migration involved in heart formation decreased process quality, abnormal fb9Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
aortic arch has extra parts of type blood vessel endothelial cell, abnormal fb9Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis decreased process quality, abnormal sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis process quality, ameliorated sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 chemical treatment by environment: 3-(N-HYDROXYCARBOXAMIDO)-2-ISOBUTYLPROPANOYL-TRP-METHYLAMIDE Fig. 5 with image from Rydeen et al., 2016
cardiac muscle cell external to heart, abnormal sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
cardiac muscle cell mislocalised, abnormal sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis decreased process quality, abnormal sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with imageFig. 5 with image from Rydeen et al., 2016
ventricular myocardium cardiac muscle cell mislocalised, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
cardiac ventricle cardiac muscle cell circular, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
ventricular myocardium cell-cell junction ab1-ctnnb labeling spatial pattern, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
ventricular myocardium bicellular tight junction ab1-tjp1 labeling spatial pattern, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
cardiac ventricle establishment of cell polarity decreased process quality, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
endocardium has fewer parts of type endothelial cell, abnormal ubs1Tg + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 7 with image from Rydeen et al., 2014
cranial vasculature has fewer parts of type endothelial cell, abnormal ubs1Tg + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 7 with image from Rydeen et al., 2014
ventricular myocardium cardiac muscle cell mislocalised, abnormal f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle has number of cardiac muscle cell, ameliorated f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac muscle cell external to heart, abnormal f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
aortic arch 4 has extra parts of type blood vessel endothelial cell, abnormal fb9Tg ; ubs1Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
cardiac ventricle cell migration involved in heart formation decreased process quality, abnormal fb9Tg ; ubs1Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
aortic arch 3 has extra parts of type blood vessel endothelial cell, abnormal fb9Tg ; ubs1Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis process quality, ameliorated sd22Tg ; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
ventricular myocardium increased distance ventricular endocardium, abnormal twu34Tg ; ci5Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal twu34Tg ; ci5Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
OTHER MO1-cyp26c1 MORPHOLINO PAGES No links to external sites
CITATIONS (7)