Morpholino

MO3-rbpja

ID

ZDB-MRPHLNO-070410-10

Name

MO3-rbpja

Previous Names

Su(H)1 MO (1)

Target

rbpja (1)

Sequence

5' - CCGGTGTGACAAATAACGCCAGGAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This morpholino matches a cDNA sequenced and described by Echeverri and Oates (2007. Dev. Biol. 131:388-403) but there is a 1 nucleotide mismatch to genomic sequences in the DNA sequence databanks as of 4/12/2007.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-rbpja

Expressed Gene	Anatomy	Figures
cyp26a1	segmental plate tail bud	Fig. 6 from Echeverri et al., 2007
dlc	segmental plate	Fig. 5 from Echeverri et al., 2007
her1	presumptive segmental plate segmental plate	Fig. 5 from Echeverri et al., 2007
isl1a	Rohon-Beard neuron trigeminal ganglion	Fig. 2 from Echeverri et al., 2007
myl7	primitive heart tube	Fig. 3 from Echeverri et al., 2007
ttn.2	myotome	Fig. 4 from Echeverri et al., 2007

Phenotype

Phenotype resulting from MO3-rbpja

Phenotype	Fish	Figures
heart position, abnormal	WT + MO3-rbpja	Fig. 3 from Echeverri et al., 2007
heart tube decreased length, abnormal	WT + MO3-rbpja	Fig. 3 from Echeverri et al., 2007
post-vent region structure, abnormal	WT + MO3-rbpja	Fig. 4 from Echeverri et al., 2007
Rohon-Beard neuron increased amount, abnormal	WT + MO3-rbpja	Fig. 2 from Echeverri et al., 2007
somite spatial pattern, abnormal	WT + MO3-rbpja	Fig. 4 from Echeverri et al., 2007

Phenotype of all Fish created by or utilizing MO3-rbpja

Phenotype	Fish	Conditions	Figures
Rohon-Beard neuron increased amount, abnormal	WT + MO3-rbpja	standard conditions	Fig. 2 from Echeverri et al., 2007
heart tube decreased length, abnormal	WT + MO3-rbpja	standard conditions	Fig. 3 from Echeverri et al., 2007
somite spatial pattern, abnormal	WT + MO3-rbpja	standard conditions	Fig. 4 from Echeverri et al., 2007
post-vent region structure, abnormal	WT + MO3-rbpja	standard conditions	Fig. 4 from Echeverri et al., 2007
heart position, abnormal	WT + MO3-rbpja	standard conditions	Fig. 3 from Echeverri et al., 2007
Rohon-Beard neuron increased amount, abnormal	WT + MO1-rbpjb + MO2-rbpjb + MO3-rbpja	standard conditions	Fig. 2 from Echeverri et al., 2007
motor neuron increased amount, abnormal	WT + MO1-rbpjb + MO2-rbpjb + MO3-rbpja	standard conditions	Fig. 2 from Echeverri et al., 2007
trigeminal ganglion increased size, abnormal	WT + MO1-rbpjb + MO2-rbpjb + MO3-rbpja	standard conditions	Fig. 2 from Echeverri et al., 2007
post-vent region structure, abnormal	WT + MO1-rbpjb + MO2-rbpjb + MO3-rbpja	standard conditions	Fig. 4 from Echeverri et al., 2007
somite spatial pattern, abnormal	WT + MO1-rbpjb + MO2-rbpjb + MO3-rbpja	standard conditions	Fig. 4 from Echeverri et al., 2007
heart position, abnormal	WT + MO1-rbpjb + MO2-rbpjb + MO3-rbpja	standard conditions	Fig. 3 from Echeverri et al., 2007

Citations