header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070410-1
Morpholino Name: MO1-cyp26b1
Target: cyp26b1 (1)
Sequence:
5' - CTCGAAGAGCATGGCTGTGAACGTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets start ATG.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-cyp26b1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-cyp26b1
Expressed Gene Anatomy Figures
ins Fig. 3 with image from Kinkel et al., 2009
PHENOTYPE
Phenotype resulting from MO1-cyp26b1
No data available

Phenotype of all Fish created by or utilizing MO1-cyp26b1
Phenotype Fish Conditions Figures
pancreas mislocalised anteriorly, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 standard conditions Fig. 3 with image from Kinkel et al., 2009
pancreas development process quality, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 standard conditions Fig. 3 with image from Kinkel et al., 2009
pancreas increased length, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 standard conditions Fig. 3 with image from Kinkel et al., 2009
rhombomere 2 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 6 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
pancreas mislocalised anteriorly, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 3 with image from Kinkel et al., 2009
rhombomere 4 increased size, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 2 with imageFig. S4 with image from Hernandez et al., 2007
vagal lobe distended, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 2 with image from Hernandez et al., 2007
pancreas increased length, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 3 with image from Kinkel et al., 2009
pancreas development process quality, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 3 with image from Kinkel et al., 2009
pharyngeal endoderm condensed, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 2 with image from Hernandez et al., 2007
hindbrain wholly posterioralized, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 2 with imageFig. S4 with image from Hernandez et al., 2007
rhombomere 4 increased size, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-dnd1 standard conditions Fig. 2 with imageFig. S4 with image from Hernandez et al., 2007
rhombomere 4 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal fci3Tg/fci3Tg + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 6 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 2 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
OTHER MO1-cyp26b1 MORPHOLINO PAGES No links to external sites
CITATIONS (4)