Morpholino

MO1-rpl28

ID

ZDB-MRPHLNO-070327-9

Name

MO1-rpl28

Previous Names

Target

Sequence

5' - CATTGCAGGTGAGGCGATGCCATGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-rpl28

No data available

Phenotype

Phenotype resulting from MO1-rpl28

Phenotype	Fish	Figures
ball increased size, abnormal	AB + MO1-rpl28	Fig. 3 from Uechi et al., 2006
cerebellum aplastic, abnormal	AB + MO1-rpl28	Fig. 3 from Uechi et al., 2006
extension decreased length, abnormal	AB + MO1-rpl28	Fig. 3 from Uechi et al., 2006
extension deformed, abnormal	AB + MO1-rpl28	Fig. 3 from Uechi et al., 2006
fin deformed, abnormal	AB + MO1-rpl28	Fig. 3 from Uechi et al., 2006
fourth ventricle increased size, abnormal	AB + MO1-rpl28	Fig. 3 from Uechi et al., 2006
head protruding, abnormal	AB + MO1-rpl28	Fig. 2 from Uechi et al., 2006
midbrain hindbrain boundary deformed, abnormal	AB + MO1-rpl28	Fig. 3 from Uechi et al., 2006
optic tectum increased size, abnormal	AB + MO1-rpl28	Fig. 3 from Uechi et al., 2006
otic placode aplastic, abnormal	AB + MO1-rpl28	Fig. 3 from Uechi et al., 2006
otic placode decreased size, abnormal	AB + MO1-rpl28	Fig. 3 from Uechi et al., 2006
otolith organ decreased size, abnormal	AB + MO1-rpl28	Fig. 3 from Uechi et al., 2006
otolith organ deformed, abnormal	AB + MO1-rpl28	Fig. 3 from Uechi et al., 2006
post-vent region bent, abnormal	AB + MO1-rpl28	Fig. 3 from Uechi et al., 2006
telencephalon deformed, abnormal	AB + MO1-rpl28	Fig. 3 from Uechi et al., 2006

Phenotype of all Fish created by or utilizing MO1-rpl28

Phenotype	Fish	Conditions	Figures
post-vent region bent, abnormal	AB + MO1-rpl28	standard conditions	Fig. 3 from Uechi et al., 2006
fourth ventricle increased size, abnormal	AB + MO1-rpl28	standard conditions	Fig. 3 from Uechi et al., 2006
otolith organ deformed, abnormal	AB + MO1-rpl28	standard conditions	Fig. 3 from Uechi et al., 2006
head protruding, abnormal	AB + MO1-rpl28	standard conditions	Fig. 2 from Uechi et al., 2006
extension deformed, abnormal	AB + MO1-rpl28	standard conditions	Fig. 3 from Uechi et al., 2006
optic tectum increased size, abnormal	AB + MO1-rpl28	standard conditions	Fig. 3 from Uechi et al., 2006
cerebellum aplastic, abnormal	AB + MO1-rpl28	standard conditions	Fig. 3 from Uechi et al., 2006
otic placode aplastic, abnormal	AB + MO1-rpl28	standard conditions	Fig. 3 from Uechi et al., 2006
extension decreased length, abnormal	AB + MO1-rpl28	standard conditions	Fig. 3 from Uechi et al., 2006
otolith organ decreased size, abnormal	AB + MO1-rpl28	standard conditions	Fig. 3 from Uechi et al., 2006
fin deformed, abnormal	AB + MO1-rpl28	standard conditions	Fig. 3 from Uechi et al., 2006
telencephalon deformed, abnormal	AB + MO1-rpl28	standard conditions	Fig. 3 from Uechi et al., 2006
midbrain hindbrain boundary deformed, abnormal	AB + MO1-rpl28	standard conditions	Fig. 3 from Uechi et al., 2006
ball increased size, abnormal	AB + MO1-rpl28	standard conditions	Fig. 3 from Uechi et al., 2006
otic placode decreased size, abnormal	AB + MO1-rpl28	standard conditions	Fig. 3 from Uechi et al., 2006

Citations