Morpholino

MO1-rpl5a

ID
ZDB-MRPHLNO-070327-5
Name
MO1-rpl5a
Previous Names
  • MO117 (1)
  • rpl5 MO (1)
Target
Sequence
5' - ACCCATTTTGTGATCGTTTGTTCTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rpl5a
Phenotype
Phenotype resulting from MO1-rpl5a
Phenotype Fish Figures
angioblastic mesenchymal cell tal1 expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 Fig. 2 with image from Wan et al., 2016
angioblastic mesenchymal cell tal1 expression decreased amount, abnormal AB + MO1-rpl5a Fig. 2 with image from Wan et al., 2016
common myeloid progenitor spi1b expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 Fig. 2 with image from Wan et al., 2016
common myeloid progenitor spi1b expression decreased amount, abnormal AB + MO1-rpl5a Fig. 2 with image from Wan et al., 2016
definitive hemopoiesis disrupted, abnormal AB + MO1-rpl5a Fig. 2 with image from Wan et al., 2016
embryo development disrupted, abnormal AB + MO1-rpl5a Fig. 1 with image from Wan et al., 2016
erythroid progenitor cell gata1a expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 Fig. 2 with image from Wan et al., 2016
erythroid progenitor cell gata1a expression decreased amount, abnormal AB + MO1-rpl5a Fig. 2 with image from Wan et al., 2016
fourth ventricle morphology, abnormal AB + MO1-rpl5a Fig. 3 with image from Uechi et al., 2006
head decreased size, abnormal AB + MO1-rpl5a Fig. 1 with image from Wan et al., 2016
heart nucleate erythrocyte amount, ameliorated AB + MO1-rpl5a + MO4-tp53 Fig. 1 with image from Wan et al., 2016
heart nucleate erythrocyte decreased amount, abnormal AB + MO1-rpl5a Fig. 1 with image from Wan et al., 2016
hematopoietic stem cell myb expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 Fig. 2 with image from Wan et al., 2016
hematopoietic stem cell runx1 expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 Fig. 2 with image from Wan et al., 2016
hematopoietic stem cell runx1 expression decreased amount, abnormal AB + MO1-rpl5a Fig. 2 with image from Wan et al., 2016
hematopoietic stem cell myb expression decreased amount, abnormal AB + MO1-rpl5a Fig. 2 with image from Wan et al., 2016
hindbrain morphology, abnormal AB + MO1-rpl5a Fig. 3 with image from Uechi et al., 2006
midbrain hindbrain boundary morphology, abnormal AB + MO1-rpl5a Fig. 3 with image from Uechi et al., 2006
nucleate erythrocyte decreased amount, abnormal AB + MO1-rpl5a Fig. 1 with image from Wan et al., 2016
optic tectum morphology, abnormal AB + MO1-rpl5a Fig. 3 with image from Uechi et al., 2006
post-vent region curved ventral, abnormal AB + MO1-rpl5a Fig. 1 with image from Wan et al., 2016
post-vent region morphology, abnormal AB + MO1-rpl5a Fig. 3 with image from Uechi et al., 2006
primitive hemopoiesis disrupted, abnormal AB + MO1-rpl5a Fig. 2 with image from Wan et al., 2016
whole organism utp4 expression decreased amount, abnormal AB + MO1-rpl5a Fig. 3 from Wan et al., 2016
whole organism nol6 expression decreased amount, abnormal AB + MO1-rpl5a Fig. 3 from Wan et al., 2016
whole organism tars1 expression decreased amount, abnormal AB + MO1-rpl5a Fig. 3 from Wan et al., 2016
whole organism noc2l expression decreased amount, abnormal AB + MO1-rpl5a Fig. 3 from Wan et al., 2016
whole organism abce1 expression decreased amount, abnormal AB + MO1-rpl5a Fig. 3 from Wan et al., 2016
whole organism dre-mir-722 expression increased amount, abnormal AB + MO1-rpl5a Fig. 5 from Wan et al., 2016
whole organism mir737 expression increased amount, abnormal AB + MO1-rpl5a Fig. 5 from Wan et al., 2016
whole organism mir155 expression increased amount, abnormal AB + MO1-rpl5a Fig. 5 from Wan et al., 2016
whole organism mir142a expression increased amount, abnormal AB + MO1-rpl5a Fig. 5 from Wan et al., 2016
whole organism mir10a expression increased amount, abnormal AB + MO1-rpl5a Fig. 5 from Wan et al., 2016
whole organism mir223 expression increased amount, abnormal AB + MO1-rpl5a Fig. 5 from Wan et al., 2016
Phenotype of all Fish created by or utilizing MO1-rpl5a
Phenotype Fish Conditions Figures
optic tectum morphology, abnormal AB + MO1-rpl5a standard conditions Fig. 3 with image from Uechi et al., 2006
whole organism abce1 expression decreased amount, abnormal AB + MO1-rpl5a standard conditions Fig. 3 from Wan et al., 2016
hematopoietic stem cell myb expression decreased amount, abnormal AB + MO1-rpl5a standard conditions Fig. 2 with image from Wan et al., 2016
midbrain hindbrain boundary morphology, abnormal AB + MO1-rpl5a standard conditions Fig. 3 with image from Uechi et al., 2006
whole organism mir10a expression increased amount, abnormal AB + MO1-rpl5a standard conditions Fig. 5 from Wan et al., 2016
erythroid progenitor cell gata1a expression decreased amount, abnormal AB + MO1-rpl5a standard conditions Fig. 2 with image from Wan et al., 2016
primitive hemopoiesis disrupted, abnormal AB + MO1-rpl5a standard conditions Fig. 2 with image from Wan et al., 2016
hindbrain morphology, abnormal AB + MO1-rpl5a standard conditions Fig. 3 with image from Uechi et al., 2006
whole organism nol6 expression decreased amount, abnormal AB + MO1-rpl5a standard conditions Fig. 3 from Wan et al., 2016
whole organism utp4 expression decreased amount, abnormal AB + MO1-rpl5a standard conditions Fig. 3 from Wan et al., 2016
whole organism mir737 expression increased amount, abnormal AB + MO1-rpl5a standard conditions Fig. 5 from Wan et al., 2016
whole organism mir223 expression increased amount, abnormal AB + MO1-rpl5a standard conditions Fig. 5 from Wan et al., 2016
common myeloid progenitor spi1b expression decreased amount, abnormal AB + MO1-rpl5a standard conditions Fig. 2 with image from Wan et al., 2016
embryo development disrupted, abnormal AB + MO1-rpl5a standard conditions Fig. 1 with image from Wan et al., 2016
whole organism dre-mir-722 expression increased amount, abnormal AB + MO1-rpl5a standard conditions Fig. 5 from Wan et al., 2016
post-vent region morphology, abnormal AB + MO1-rpl5a standard conditions Fig. 3 with image from Uechi et al., 2006
hematopoietic stem cell runx1 expression decreased amount, abnormal AB + MO1-rpl5a standard conditions Fig. 2 with image from Wan et al., 2016
whole organism mir142a expression increased amount, abnormal AB + MO1-rpl5a standard conditions Fig. 5 from Wan et al., 2016
head decreased size, abnormal AB + MO1-rpl5a standard conditions Fig. 1 with image from Wan et al., 2016
nucleate erythrocyte decreased amount, abnormal AB + MO1-rpl5a standard conditions Fig. 1 with image from Wan et al., 2016
whole organism mir155 expression increased amount, abnormal AB + MO1-rpl5a standard conditions Fig. 5 from Wan et al., 2016
post-vent region curved ventral, abnormal AB + MO1-rpl5a standard conditions Fig. 1 with image from Wan et al., 2016
whole organism tars1 expression decreased amount, abnormal AB + MO1-rpl5a standard conditions Fig. 3 from Wan et al., 2016
heart nucleate erythrocyte decreased amount, abnormal AB + MO1-rpl5a standard conditions Fig. 1 with image from Wan et al., 2016
angioblastic mesenchymal cell tal1 expression decreased amount, abnormal AB + MO1-rpl5a standard conditions Fig. 2 with image from Wan et al., 2016
fourth ventricle morphology, abnormal AB + MO1-rpl5a standard conditions Fig. 3 with image from Uechi et al., 2006
whole organism noc2l expression decreased amount, abnormal AB + MO1-rpl5a standard conditions Fig. 3 from Wan et al., 2016
definitive hemopoiesis disrupted, abnormal AB + MO1-rpl5a standard conditions Fig. 2 with image from Wan et al., 2016
hematopoietic stem cell runx1 expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 2 with image from Wan et al., 2016
hematopoietic stem cell myb expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 2 with image from Wan et al., 2016
common myeloid progenitor spi1b expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 2 with image from Wan et al., 2016
erythroid progenitor cell gata1a expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 2 with image from Wan et al., 2016
angioblastic mesenchymal cell tal1 expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 2 with image from Wan et al., 2016
heart nucleate erythrocyte amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 1 with image from Wan et al., 2016
neurocranium malformed, exacerbated WT + MO1-rpl5a chemical treatment by environment: ethanol Fig. 1 with image from Berres et al., 2017
embryonic cranial skeleton morphogenesis decreased process quality, exacerbated WT + MO1-rpl5a chemical treatment by environment: ethanol Fig. 1 with image from Berres et al., 2017
embryonic neurocranium morphogenesis decreased process quality, exacerbated WT + MO1-rpl5a chemical treatment by environment: ethanol Fig. 1 with image from Berres et al., 2017
head apoptotic process increased occurrence, exacerbated WT + MO1-rpl5a chemical treatment by environment: ethanol Fig. 2 with image from Berres et al., 2017
mandibular arch skeleton malformed, exacerbated WT + MO1-rpl5a chemical treatment by environment: ethanol Fig. 1 with image from Berres et al., 2017
cerebellum aplastic, abnormal AB + MO1-rpl5a + MO1-rpl5b standard conditions Fig. 3 with image from Uechi et al., 2006
extension decreased length, abnormal AB + MO1-rpl5a + MO1-rpl5b standard conditions Fig. 3 with image from Uechi et al., 2006
optic tectum opaque, abnormal AB + MO1-rpl5a + MO1-rpl5b standard conditions Fig. 3 with image from Uechi et al., 2006
ball increased size, abnormal AB + MO1-rpl5a + MO1-rpl5b standard conditions Fig. 3 with image from Uechi et al., 2006
optic tectum increased size, abnormal AB + MO1-rpl5a + MO1-rpl5b standard conditions Fig. 3 with image from Uechi et al., 2006
lens decreased size, abnormal AB + MO1-rpl5a + MO1-rpl5b standard conditions Fig. 3 with image from Uechi et al., 2006
retina decreased size, abnormal AB + MO1-rpl5a + MO1-rpl5b standard conditions Fig. 3 with image from Uechi et al., 2006
fin deformed, abnormal AB + MO1-rpl5a + MO1-rpl5b standard conditions Fig. 3 with image from Uechi et al., 2006
otic placode decreased size, abnormal AB + MO1-rpl5a + MO1-rpl5b standard conditions Fig. 3 with image from Uechi et al., 2006
fourth ventricle opaque, abnormal AB + MO1-rpl5a + MO1-rpl5b standard conditions Fig. 3 with image from Uechi et al., 2006
midbrain hindbrain boundary aplastic, abnormal AB + MO1-rpl5a + MO1-rpl5b standard conditions Fig. 3 with image from Uechi et al., 2006
hindbrain undulate, abnormal AB + MO1-rpl5a + MO1-rpl5b standard conditions Fig. 3 with image from Uechi et al., 2006
apoptotic process increased occurrence, abnormal WT + MO1-rpl11 + MO1-rpl23 + MO1-rpl5a standard conditions Fig. S5 with image from Chakraborty et al., 2009
brain deformed, abnormal WT + MO1-rpl11 + MO1-rpl23 + MO1-rpl5a standard conditions Fig. S5 with image from Chakraborty et al., 2009
brain morphogenesis disrupted, abnormal WT + MO1-rpl11 + MO1-rpl23 + MO1-rpl5a standard conditions Fig. S5 with image from Chakraborty et al., 2009
Citations