header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070327-10
Morpholino Name: MO1-rpl35
Target: rpl35 (1)
Sequence:
5' - GGTCTCTGGCCTTGATCTTTGCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-rpl35 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-rpl35 No data available
PHENOTYPE
Phenotype resulting from MO1-rpl35
Phenotype of all Fish created by or utilizing MO1-rpl35
Phenotype Fish Conditions Figures
extension decreased length, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
hindbrain undulate, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
forebrain protruding, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
retina decreased size, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
ball increased size, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
optic tectum increased size, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
extension decreased thickness, abnormal AB + MO1-rpl35 standard conditions Fig. 1 from Yadav et al., 2014
Fig. 3 with image from Uechi et al., 2006
otolith organ deformed, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
optic tectum opaque, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
post-vent region bent, abnormal AB + MO1-rpl35 standard conditions Fig. 1 from Yadav et al., 2014
otic placode aplastic, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
fourth ventricle increased size, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
whole organism decreased length, abnormal AB + MO1-rpl35 standard conditions Fig. 1 from Yadav et al., 2014
brain aplastic, abnormal AB + MO1-rpl35 standard conditions Fig. 1 from Yadav et al., 2014
eye decreased size, abnormal AB + MO1-rpl35 standard conditions Fig. 1 from Yadav et al., 2014
otic placode decreased size, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
fin aplastic, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
post-vent region deformed, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
ball opaque, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
nucleate erythrocyte decreased amount, abnormal WT + MO1-rpl35 standard conditions Fig. 5 from Uechi et al., 2008
nucleate erythrocyte decreased amount, abnormal WT + MO1-rpl35 + MO4-tp53 standard conditions Fig. 2 from Yadav et al., 2014
nucleate erythrocyte decreased amount, abnormal tp53zdf1/zdf1 + MO1-rpl35 standard conditions Fig. 2 from Yadav et al., 2014
Genome Resources:
CITATIONS (3)