header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070304-3
Morpholino Name: MO1-fyna,fynb
Targets: fyna (1), fynb (1)
Previous Names: Fyn-MO (1), MO1-fyna+fynb

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGTCCTTACATTGCACACAGCCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This morpholino targets 2 genes.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-fyna,fynb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-fyna,fynb No data available
PHENOTYPE
Phenotype resulting from MO1-fyna,fynb
No data available

Phenotype of all Fish created by or utilizing MO1-fyna,fynb
Phenotype Fish Conditions Figures
epiboly arrested, abnormal WT + MO1-fyna,fynb standard conditions Fig. 2 with image from Sempou et al., 2016
eye fused with eye, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 1Fig. 3 from Jopling et al., 2005
mediolateral intercalation decreased rate, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 2 from Jopling et al., 2005
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 1 from Jopling et al., 2005
convergent extension disrupted, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 2 with image from Lemeer et al., 2007
whole organism ab2-ctnnb labeling decreased amount, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 3 with image from Sempou et al., 2016
epiboly arrested, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 2 with image from Sempou et al., 2016
whole organism left-right axis increased width, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 1 from Jopling et al., 2005
forebrain structure, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 3 from Jopling et al., 2005
DEL cytosol ab2-ctnnb labeling mislocalised, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 3 with image from Sempou et al., 2016
DEL intracellular ab2-ctnnb labeling mislocalised, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 3 with image from Sempou et al., 2016
dorsal convergence decreased rate, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 2 from Jopling et al., 2005
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 1Fig. 3 from Jopling et al., 2005
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-fyna,fynb + MO1-wnt5b + MO1-yes1 standard conditions Fig. 5 from Jopling et al., 2005
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-fyna,fynb + MO1-wnt11 + MO1-yes1 standard conditions Fig. 3 from Jopling et al., 2005
forebrain structure, abnormal WT + MO1-fyna,fynb + MO1-wnt11 + MO1-yes1 standard conditions Fig. 3 from Jopling et al., 2005
eye fused with eye, abnormal WT + MO1-fyna,fynb + MO1-wnt11 + MO1-yes1 standard conditions Fig. 3 from Jopling et al., 2005
myelination decreased process quality, abnormal ue2Tg + MO1-fyna,fynb standard conditions Fig. 4 with image from Czopka et al., 2013
oligodendrocyte has fewer parts of type oligodendrocyte myelin sheath, abnormal ue2Tg + MO1-fyna,fynb standard conditions Fig. 4 with image from Czopka et al., 2013
OTHER MO1-fyna,fynb MORPHOLINO PAGES No links to external sites
CITATIONS (7)