header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070301-1
Morpholino Name: MO1-espl1
Target: espl1 (1)
Sequence:
5' - ACTGGCTGAGTGTCTGCAGTTTGGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Matches AL928872 and AL929200; 1 bp mismatch with AL954698. Possible polymorphism.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-espl1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-espl1 No data available
PHENOTYPE
Phenotype resulting from MO1-espl1
Phenotype of all Fish created by or utilizing MO1-espl1
OTHER MO1-espl1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)