ZFIN ID: ZDB-MRPHLNO-070216-1
Morpholino Name: MO1-otpb
Target: otpb (1)
Sequence:
5' - CCAAGAGGTCGGCATGAGAGAGCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-otpb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-otpb
Expressed Gene Anatomy Figures
neurog1 Fig. 10 with image from Del Giacco et al., 2006
th Fig. 10 with image from Del Giacco et al., 2006
PHENOTYPE
Phenotype resulting from MO1-otpb
No data available

Phenotype of all Fish created by or utilizing MO1-otpb
No data available
OTHER MO1-otpb MORPHOLINO PAGESNo links to external sites
CITATIONS (2)