header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070209-4
Morpholino Name: MO1-lmo4a
Target: lmo4a (1)
Previous Name: MO1-lmo4 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGCTTTCCACACGACTGTTCACCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-lmo4a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-lmo4a
Expressed Gene Anatomy Figures
hbbe1.1 Fig. 5 with image from Meier et al., 2006
runx1 Fig. 5 with image from Meier et al., 2006
PHENOTYPE
Phenotype resulting from MO1-lmo4a
Phenotype of all Fish created by or utilizing MO1-lmo4a
OTHER MO1-lmo4a MORPHOLINO PAGESNo links to external sites
CITATIONS (2)