ZFIN ID: ZDB-MRPHLNO-070206-8
Morpholino Name: MO3-jag2b
Target: jag2b (1)
Previous Name: MO3-jag2

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GACGAATACTCACTGTTCTGAGTGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice blocking morpholino
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-jag2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-jag2b
Expressed Gene Anatomy Figures
ins Fig. S2 with image from Zecchin et al., 2007
prss1 Fig. S2 with image from Zecchin et al., 2007
PHENOTYPE
Phenotype resulting from MO3-jag2b
No data available

Phenotype of all Fish created by or utilizing MO3-jag2b
No data available
OTHER MO3-jag2b MORPHOLINO PAGESNo links to external sites
CITATIONS (2)