ZFIN ID: ZDB-MRPHLNO-070130-6
Morpholino Name: MO4-sox9b
Target: sox9b (1)
Previous Name: Sox9b.MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGTGTGTGTGTGTGTGTGTGAGCAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This MO targets a conserved genomic repeat that is found thousands of places throughout the genome.
TARGET LOCATIONS
View all 43 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-sox9b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-sox9b No data available
PHENOTYPE
Phenotype resulting from MO4-sox9b
Phenotype Figures
dorsal root ganglion decreased amount, abnormal Fig. 6 with image from Carney et al., 2006
dorsal root ganglion irregular spatial pattern, abnormal Fig. 6 with image from Carney et al., 2006
head decreased size, abnormal Fig. 6 with image from Carney et al., 2006
post-vent region increased curvature, abnormal Fig. 6 with image from Carney et al., 2006

Phenotype of all Fish created by or utilizing MO4-sox9b
Phenotype Fish Conditions Figures
dorsal root ganglion irregular spatial pattern, abnormal WT + MO4-sox9b standard conditions Fig. 6 with image from Carney et al., 2006
post-vent region increased curvature, abnormal WT + MO4-sox9b standard conditions Fig. 6 with image from Carney et al., 2006
head decreased size, abnormal WT + MO4-sox9b standard conditions Fig. 6 with image from Carney et al., 2006
dorsal root ganglion decreased amount, abnormal WT + MO4-sox9b standard conditions Fig. 6 with image from Carney et al., 2006
head decreased size, abnormal sox10t3/t3 + MO4-sox9b standard conditions Fig. 6 with image from Carney et al., 2006
post-vent region increased curvature, abnormal sox10t3/t3 + MO4-sox9b standard conditions Fig. 6 with image from Carney et al., 2006
dorsal root ganglion irregular spatial pattern, abnormal sox10t3/t3 + MO4-sox9b standard conditions Fig. 6 with image from Carney et al., 2006
dorsal root ganglion decreased amount, abnormal sox10t3/t3 + MO4-sox9b standard conditions Fig. 6 with image from Carney et al., 2006
OTHER MO4-sox9b MORPHOLINO PAGESNo links to external sites
CITATIONS (1)