Morpholino

MO1-metap2b

ID

ZDB-MRPHLNO-061013-1

Name

MO1-metap2b

Previous Names

MO1-metap2

Target

metap2b (1)

Sequence

5' - CATGTCTTTACCCATCTTGCACAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-metap2b

Expressed Gene	Anatomy	Figures
efnb2a	dorsal aorta	Fig. 3 from Ma et al., 2011
flt4	posterior cardinal vein	Fig. 3 from Ma et al., 2011
mpx	myeloid cell	Fig. 2 from Ma et al., 2011
myb	ventral wall of dorsal aorta hematopoietic stem cell	Fig. 2 from Ma et al., 2011
myod1	somite	Fig. S3 from Zhang et al., 2006

Phenotype

Phenotype resulting from MO1-metap2b

Phenotype	Fish	Figures
convergent extension involved in axis elongation disrupted, abnormal	WT + MO1-metap2b	Fig. 3 from Zhang et al., 2006
initiator methionyl aminopeptidase activity decreased occurrence, abnormal	WT + MO1-metap2b	Fig. 5 from Ma et al., 2011
intersegmental vessel morphology, abnormal	y1Tg + MO1-metap2b	Fig. 3 from Ma et al., 2011
myeloid cell differentiation process quality, abnormal	WT + MO1-metap2b	Fig. 2 from Ma et al., 2011
non-canonical Wnt signaling pathway disrupted, abnormal	WT + MO1-metap2b	text only from Ma et al., 2011
post-anal tail morphogenesis disrupted, abnormal	WT + MO1-metap2b	Fig. 3 from Zhang et al., 2006
post-vent region decreased length, abnormal	WT + MO1-metap2b	Fig. 3 from Zhang et al., 2006
protein phosphorylation increased occurrence, abnormal	y1Tg + MO1-metap2b	Fig. 5 from Ma et al., 2011
sprouting angiogenesis disrupted, abnormal	y1Tg + MO1-metap2b	Fig. 3 from Ma et al., 2011
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal	WT + MO1-metap2b	Fig. 2 from Ma et al., 2011

Phenotype of all Fish created by or utilizing MO1-metap2b

Phenotype	Fish	Conditions	Figures
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal	WT + MO1-metap2b	standard conditions	Fig. 2 from Ma et al., 2011
convergent extension involved in axis elongation disrupted, abnormal	WT + MO1-metap2b	standard conditions	Fig. 3 from Zhang et al., 2006
post-anal tail morphogenesis disrupted, abnormal	WT + MO1-metap2b	standard conditions	Fig. 3 from Zhang et al., 2006
post-vent region decreased length, abnormal	WT + MO1-metap2b	standard conditions	Fig. 3 from Zhang et al., 2006
non-canonical Wnt signaling pathway disrupted, abnormal	WT + MO1-metap2b	standard conditions	text only from Ma et al., 2011
initiator methionyl aminopeptidase activity decreased occurrence, abnormal	WT + MO1-metap2b	standard conditions	Fig. 5 from Ma et al., 2011
myeloid cell differentiation process quality, abnormal	WT + MO1-metap2b	standard conditions	Fig. 2 from Ma et al., 2011
sprouting angiogenesis disrupted, abnormal	y1Tg + MO1-metap2b	standard conditions	Fig. 3 from Ma et al., 2011
intersegmental vessel morphology, abnormal	y1Tg + MO1-metap2b	standard conditions	Fig. 3 from Ma et al., 2011
protein phosphorylation increased occurrence, abnormal	y1Tg + MO1-metap2b	standard conditions	Fig. 5 from Ma et al., 2011
post-vent region decreased length, abnormal	WT + MO1-metap2b + MO1-wnt5b	standard conditions	Fig. 3 from Zhang et al., 2006
convergent extension involved in axis elongation disrupted, abnormal	WT + MO1-metap2b + MO1-wnt5b	standard conditions	Fig. 3 from Zhang et al., 2006
somite increased width, abnormal	WT + MO1-metap2b + MO1-wnt5b	standard conditions	Fig. 3 from Zhang et al., 2006
post-anal tail morphogenesis disrupted, abnormal	WT + MO1-metap2b + MO1-wnt5b	standard conditions	Fig. 3 from Zhang et al., 2006

Citations