header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060928-5
Morpholino Name: MO1-cebpb
Target: cebpb (1)
Sequence:
5' - GATCTTAACACCCGCCGGATTGCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-cebpb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-cebpb
Expressed Gene Anatomy Figures
aicda Fig. 3 with image from Rai et al., 2010
cebpb Fig. 5 from Eisinger et al., 2006
gadd45ab Fig. 3 with image from Rai et al., 2010
mbd4 Fig. 3 with image from Rai et al., 2010
nos2a Fig. 6 with image from Hall et al., 2012
ptgs2a Fig. 5 from Eisinger et al., 2006
PHENOTYPE
Phenotype resulting from MO1-cebpb
No data available

Phenotype of all Fish created by or utilizing MO1-cebpb
OTHER MO1-cebpb MORPHOLINO PAGESNo links to external sites
CITATIONS (6)