ZFIN ID: ZDB-MRPHLNO-060927-4
Morpholino Name: MO1-tyr
Target: tyr (1)
Sequence:
5' - GAGACATGATGATGAAGAGTCGAGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-tyr No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-tyr No data available
PHENOTYPE
Phenotype resulting from MO1-tyr
Phenotype Figures
retinal pigmented epithelium melanosome immature, abnormal Fig. 3 with image from Burgoyne et al., 2015

Phenotype of all Fish created by or utilizing MO1-tyr
Phenotype Fish Conditions Figures
retinal pigmented epithelium melanosome immature, abnormal WT + MO1-tyr standard conditions Fig. 3 with image from Burgoyne et al., 2015
OTHER MO1-tyr MORPHOLINO PAGES
  • MODB:263 (2)
  • CITATIONS (5)