header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060922-4
Morpholino Name: MO2-sox2
Target: sox2 (1)
Previous Name: sox2-MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AACCGATTTTCTCGAAAGTCTACCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-sox2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-sox2
Expressed Gene Anatomy Figures
atoh1a Fig. 1 with image from Millimaki et al., 2010
sox2 Fig. 1 with image from Millimaki et al., 2010
Fig. 1 from Kamachi et al., 2008
PHENOTYPE
Phenotype resulting from MO2-sox2
Phenotype of all Fish created by or utilizing MO2-sox2
Genome Resources:
CITATIONS (3)