header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060921-2
Morpholino Name: MO1-sim1a
Target: sim1a (1)
Sequence:
5' - TCGACTTCTCCTTCATGCTCTACGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: targeted to translation-start
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-sim1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-sim1a
Expressed Gene Anatomy Figures
avp Fig. 5 with image from Eaton et al., 2008
dlx2a Fig. 7 with image from Eaton et al., 2006
nkx2.2a Fig. 7 with image from Eaton et al., 2006
nkx2.4b Fig. 7 with image from Eaton et al., 2006
oxt Fig. 6 with image from Eaton et al., 2006
pou3f2a Fig. 3 from Kasher et al., 2016
pou3f2b Fig. 3 from Kasher et al., 2016
shha Fig. 7 with image from Eaton et al., 2006
sim1a Fig. 6 with image from Eaton et al., 2006
slc12a1 Fig. 7 S2 with image from Poureetezadi et al., 2016
Fig. 3 with imageFig. 6 with imageFig. 7 with imageFig. S6 with image from Cheng et al., 2015
slc12a3 Fig. 7 S2 with image from Poureetezadi et al., 2016
Fig. 3 with imageFig. 6 with imageFig. 7 with imageFig. S6 with image from Cheng et al., 2015
slc20a1a Fig. 7 S2 with image from Poureetezadi et al., 2016
Fig. 3 with imageFig. 6 with imageFig. S6 with image from Cheng et al., 2015
stc1 Fig. 3 with imageFig. 6 with imageFig. 7 with imageFig. S6 with image from Cheng et al., 2015
trpm7 Fig. 7 with image from Poureetezadi et al., 2016
Fig. 3 with imageFig. 6 with imageFig. S6 with image from Cheng et al., 2015
PHENOTYPE
Phenotype resulting from MO1-sim1a
Phenotype Figures
corpuscles of Stannius stc1 expression absent, abnormal Fig. 3 with image from Cheng et al., 2015
embryo development delayed, abnormal Fig. 6 with imageFig. 7 with image from Eaton et al., 2006
eye decreased size, abnormal Fig. 2 with image from Cheng et al., 2015
Fig. 5 with image from Eaton et al., 2008
Fig. 6 with imageFig. 7 with image from Eaton et al., 2006
head apoptotic, abnormal Fig. 2 with image from Cheng et al., 2015
head decreased size, abnormal Fig. 2 with image from Cheng et al., 2015
Fig. 5 with image from Eaton et al., 2008
Fig. 6 with imageFig. 7 with image from Eaton et al., 2006
heart edematous, abnormal Fig. 2 with image from Cheng et al., 2015
neuroendocrine cell decreased amount, abnormal Fig. 5 with image from Eaton et al., 2006
preoptic area pou3f2b expression decreased amount, abnormal Fig. 3 from Kasher et al., 2016
preoptic area pou3f2a expression decreased amount, abnormal Fig. 3 from Kasher et al., 2016
preoptic area morphology, abnormal Fig. 5 with image from Eaton et al., 2008
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal Fig. 7 S2 with image from Poureetezadi et al., 2016
pronephric nephron tubule development process quality, abnormal Fig. 6 with imageFig. 7 with image from Cheng et al., 2015
pronephric proximal convoluted tubule distended, abnormal Fig. 3 with imageFig. 6 with imageFig. S6 with image from Cheng et al., 2015
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal Fig. 7 S2 with image from Poureetezadi et al., 2016
Fig. 3 with image from Cheng et al., 2015
pronephric proximal convoluted tubule slc20a1a expression mislocalised, abnormal Fig. 3 with image from Cheng et al., 2015
pronephric proximal convoluted tubule mislocalised posteriorly, abnormal Fig. 3 with image from Cheng et al., 2015
pronephric proximal convoluted tubule straight, abnormal Fig. 2 with image from Cheng et al., 2015
pronephric proximal straight tubule absent, abnormal Fig. 7 with image from Poureetezadi et al., 2016
pronephric proximal straight tubule trpm7 expression absent, abnormal Fig. 7 with image from Poureetezadi et al., 2016
Fig. 3 with image from Cheng et al., 2015
pronephric proximal straight tubule decreased size, abnormal Fig. 3 with imageFig. S6 with image from Cheng et al., 2015
pronephric proximal tubule development decreased process quality, abnormal Fig. S6 with image from Cheng et al., 2015
pronephric proximal tubule morphogenesis decreased process quality, abnormal Fig. 2 with imageFig. 3 with image from Cheng et al., 2015
pronephric proximal tubule morphogenesis process quality, abnormal Fig. 3 with image from Cheng et al., 2015
pronephros lacks all parts of type pronephric proximal straight tubule, abnormal Fig. 6 with imageFig. S6 with image from Cheng et al., 2015
pronephros lacks all parts of type corpuscles of Stannius, abnormal Fig. 3 with imageFig. 6 with imageFig. 7 with imageFig. S6 with image from Cheng et al., 2015
renal filtration decreased process quality, abnormal Fig. 2 with image from Cheng et al., 2015

Phenotype of all Fish created by or utilizing MO1-sim1a
Phenotype Fish Conditions Figures
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal TU + MO1-sim1a standard conditions Fig. 7 S2 with image from Poureetezadi et al., 2016
Fig. 3 with image from Cheng et al., 2015
heart edematous, abnormal TU + MO1-sim1a standard conditions Fig. 2 with image from Cheng et al., 2015
pronephric distal early tubule mislocalised posteriorly, abnormal TU + MO1-sim1a chemical treatment: all-trans-retinoic acid Fig. 6 with image from Cheng et al., 2015
pronephric proximal convoluted tubule slc20a1a expression mislocalised, abnormal TU + MO1-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephric distal late tubule increased length, abnormal TU + MO1-sim1a chemical treatment: 4-(diethylamino)benzaldehyde Fig. 7 with image from Cheng et al., 2015
pronephric proximal straight tubule decreased size, abnormal TU + MO1-sim1a standard conditions Fig. 3 with imageFig. S6 with image from Cheng et al., 2015
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-sim1a control Fig. 7 S2 with image from Poureetezadi et al., 2016
pronephric distal late tubule decreased length, abnormal TU + MO1-sim1a chemical treatment: all-trans-retinoic acid Fig. 6 with image from Cheng et al., 2015
pronephric distal early tubule slc12a1 expression spatial pattern, ameliorated TU + MO1-sim1a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 7 S2 with image from Poureetezadi et al., 2016
pronephric distal early tubule mislocalised anteriorly, abnormal TU + MO1-sim1a chemical treatment: 4-(diethylamino)benzaldehyde Fig. 7 with image from Cheng et al., 2015
pronephric proximal straight tubule trpm7 expression absent, abnormal TU + MO1-sim1a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 7 with image from Poureetezadi et al., 2016
pronephric proximal convoluted tubule mislocalised posteriorly, abnormal TU + MO1-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephric proximal tubule morphogenesis process quality, abnormal TU + MO1-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephros lacks all parts of type pronephric proximal straight tubule, abnormal TU + MO1-sim1a standard conditions Fig. 6 with image from Cheng et al., 2015
pronephric nephron tubule development process quality, abnormal TU + MO1-sim1a chemical treatment: 4-(diethylamino)benzaldehyde Fig. 7 with image from Cheng et al., 2015
pronephric proximal convoluted tubule distended, abnormal TU + MO1-sim1a standard conditions Fig. 3 with imageFig. 6 with imageFig. S6 with image from Cheng et al., 2015
renal filtration decreased process quality, abnormal TU + MO1-sim1a standard conditions Fig. 2 with image from Cheng et al., 2015
pronephric proximal convoluted tubule distended, abnormal TU + MO1-sim1a chemical treatment: all-trans-retinoic acid Fig. 6 with image from Cheng et al., 2015
pronephros lacks all parts of type corpuscles of Stannius, abnormal TU + MO1-sim1a chemical treatment: all-trans-retinoic acid Fig. 6 with image from Cheng et al., 2015
pronephros lacks all parts of type corpuscles of Stannius, abnormal TU + MO1-sim1a chemical treatment: 4-(diethylamino)benzaldehyde Fig. 7 with image from Cheng et al., 2015
pronephric proximal straight tubule absent, abnormal TU + MO1-sim1a standard conditions Fig. 7 with image from Poureetezadi et al., 2016
pronephros lacks all parts of type corpuscles of Stannius, abnormal TU + MO1-sim1a standard conditions Fig. 3 with imageFig. 6 with imageFig. 7 with imageFig. S6 with image from Cheng et al., 2015
head apoptotic, abnormal TU + MO1-sim1a standard conditions Fig. 2 with image from Cheng et al., 2015
eye decreased size, abnormal TU + MO1-sim1a standard conditions Fig. 2 with image from Cheng et al., 2015
pronephric proximal straight tubule absent, abnormal TU + MO1-sim1a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 7 with image from Poureetezadi et al., 2016
pronephric nephron tubule development process quality, abnormal TU + MO1-sim1a standard conditions Fig. 6 with imageFig. 7 with image from Cheng et al., 2015
pronephric proximal convoluted tubule straight, abnormal TU + MO1-sim1a standard conditions Fig. 2 with image from Cheng et al., 2015
head decreased size, abnormal TU + MO1-sim1a standard conditions Fig. 2 with image from Cheng et al., 2015
pronephric nephron tubule development process quality, abnormal TU + MO1-sim1a chemical treatment: all-trans-retinoic acid Fig. 6 with image from Cheng et al., 2015
pronephros lacks all parts of type pronephric proximal straight tubule, abnormal TU + MO1-sim1a chemical treatment: all-trans-retinoic acid Fig. 6 with image from Cheng et al., 2015
pronephric proximal tubule morphogenesis decreased process quality, abnormal TU + MO1-sim1a standard conditions Fig. 2 with imageFig. 3 with image from Cheng et al., 2015
corpuscles of Stannius stc1 expression absent, abnormal TU + MO1-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephric proximal straight tubule trpm7 expression absent, abnormal TU + MO1-sim1a standard conditions Fig. 7 with image from Poureetezadi et al., 2016
Fig. 3 with image from Cheng et al., 2015
pronephric distal early tubule increased length, abnormal TU + MO1-sim1a chemical treatment: 4-(diethylamino)benzaldehyde Fig. 7 with image from Cheng et al., 2015
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-sim1a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 7 S2 with image from Poureetezadi et al., 2016
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal TU + MO1-sim1a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 7 S2 with image from Poureetezadi et al., 2016
pronephros lacks all parts of type corpuscles of Stannius, abnormal TU + MO1-sim1a + MO1-tp53 standard conditions Fig. S6 with image from Cheng et al., 2015
pronephric proximal convoluted tubule distended, abnormal TU + MO1-sim1a + MO1-tp53 standard conditions Fig. S6 with image from Cheng et al., 2015
pronephric proximal tubule development decreased process quality, abnormal TU + MO1-sim1a + MO1-tp53 standard conditions Fig. S6 with image from Cheng et al., 2015
pronephros lacks all parts of type pronephric proximal straight tubule, abnormal TU + MO1-sim1a + MO1-tp53 standard conditions Fig. S6 with image from Cheng et al., 2015
embryo development delayed, abnormal WT + MO1-sim1a standard conditions Fig. 6 with imageFig. 7 with image from Eaton et al., 2006
preoptic area pou3f2a expression decreased amount, abnormal WT + MO1-sim1a standard conditions Fig. 3 from Kasher et al., 2016
eye decreased size, abnormal WT + MO1-sim1a standard conditions Fig. 5 with image from Eaton et al., 2008
Fig. 6 with imageFig. 7 with image from Eaton et al., 2006
head decreased size, abnormal WT + MO1-sim1a standard conditions Fig. 5 with image from Eaton et al., 2008
Fig. 6 with imageFig. 7 with image from Eaton et al., 2006
neuroendocrine cell decreased amount, abnormal WT + MO1-sim1a standard conditions Fig. 5 with image from Eaton et al., 2006
preoptic area pou3f2b expression decreased amount, abnormal WT + MO1-sim1a standard conditions Fig. 3 from Kasher et al., 2016
preoptic area morphology, abnormal WT + MO1-sim1a standard conditions Fig. 5 with image from Eaton et al., 2008
OTHER MO1-sim1a MORPHOLINO PAGESNo links to external sites
CITATIONS (7)