Morpholino

MO1-fgf16

ID
ZDB-MRPHLNO-060831-1
Name
MO1-fgf16
Previous Names
  • Fgf16 MO (1)
Target
Sequence
5' - GAGAAATCCAGCCACCTCTGCCATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fgf16
Expressed Gene Anatomy Figures
dlx2a Fig. 4 with image from Miyake et al., 2014
Fig. 3 from Nomura et al., 2006
emx1 Fig. 4 with image from Miyake et al., 2014
fgf4 Fig. 3 from Nomura et al., 2006
fgf8a Fig. 5 with image from Miyake et al., 2014
Fig. 3 from Nomura et al., 2006
fgf10a Fig. 3 from Nomura et al., 2006
fgf16 Fig. 3 from Nomura et al., 2006
gad1b Fig. 6 with image from Miyake et al., 2014
isl1a Fig. 6 with image from Miyake et al., 2014
neurog1 Fig. 6 with image from Miyake et al., 2014
nkx6.2 Fig. 5 with image from Miyake et al., 2014
olig2 Fig. 6 with image from Miyake et al., 2014
otx2b Fig. 5 with image from Miyake et al., 2014
pax6a Fig. 4 with image from Miyake et al., 2014
pax7a Fig. 5 with image from Miyake et al., 2014
plp1a Fig. 7 with image from Miyake et al., 2014
shha Fig. 4 with image from Miyake et al., 2014
Fig. 3 from Nomura et al., 2006
slc17a6a Fig. 6 with image from Miyake et al., 2014
tbr1b Fig. 4 with image from Miyake et al., 2014
Phenotype
Phenotype resulting from MO1-fgf16
Phenotype Fish Figures
cell proliferation in forebrain decreased occurrence, abnormal WT + MO1-fgf16 Fig. 3 with image from Miyake et al., 2014
cell proliferation in midbrain decreased occurrence, abnormal WT + MO1-fgf16 Fig. 3 with image from Miyake et al., 2014
diencephalon neuron differentiation decreased process quality, abnormal WT + MO1-fgf16 Fig. 6 with image from Miyake et al., 2014
forebrain has fewer parts of type oligodendrocyte, abnormal WT + MO1-fgf16 Fig. 6 with image from Miyake et al., 2014
forebrain has fewer parts of type GABAergic neuron, abnormal WT + MO1-fgf16 Fig. 6 with image from Miyake et al., 2014
forebrain lacks all parts of type GABAergic neuron, abnormal WT + MO1-fgf16 Fig. 7 with image from Miyake et al., 2014
forebrain lacks all parts of type oligodendrocyte, abnormal WT + MO1-fgf16 Fig. 7 with image from Miyake et al., 2014
forebrain morphology, abnormal WT + MO1-fgf16 Fig. 1 with image from Miyake et al., 2014
forebrain apoptotic process increased occurrence, abnormal WT + MO1-fgf16 Fig. S1 with image from Miyake et al., 2014
forebrain development disrupted, abnormal WT + MO1-fgf16 Fig. 1 with image from Miyake et al., 2014
GABAergic neuron decreased amount, abnormal WT + MO1-fgf16 Fig. 6 with image from Miyake et al., 2014
GABAergic neuron differentiation disrupted, abnormal WT + MO1-fgf16 Fig. 6 with image,  Fig. 7 with image from Miyake et al., 2014
hindbrain lacks all parts of type oligodendrocyte, abnormal WT + MO1-fgf16 Fig. 7 with image from Miyake et al., 2014
mesenchyme pectoral fin cell population proliferation decreased occurrence, abnormal WT + MO1-fgf16 Fig. 6 from Nomura et al., 2006
midbrain morphology, abnormal WT + MO1-fgf16 Fig. 1 with image from Miyake et al., 2014
midbrain apoptotic process increased occurrence, abnormal WT + MO1-fgf16 Fig. S1 with image from Miyake et al., 2014
midbrain development disrupted, abnormal WT + MO1-fgf16 Fig. 1 with image from Miyake et al., 2014
midbrain hindbrain boundary absent, abnormal WT + MO1-fgf16 Fig. 1 with image from Miyake et al., 2014
midbrain-hindbrain boundary development disrupted, abnormal WT + MO1-fgf16 Fig. 1 with image from Miyake et al., 2014
oligodendrocyte differentiation disrupted, abnormal WT + MO1-fgf16 Fig. 6 with image,  Fig. 7 with image from Miyake et al., 2014
pectoral fin absent, abnormal WT + MO1-fgf16 Fig. 3 from Nomura et al., 2006
pectoral fin bud absent, abnormal WT + MO1-fgf16 Fig. 3 from Nomura et al., 2006
pectoral fin bud decreased depth, abnormal WT + MO1-fgf16 Fig. 3 from Nomura et al., 2006
pectoral fin bud decreased size, abnormal WT + MO1-fgf16 Fig. 3 from Nomura et al., 2006
pectoral fin development disrupted, abnormal WT + MO1-fgf16 Fig. 3 from Nomura et al., 2006
trunk bent, abnormal WT + MO1-fgf16 Fig. 3 from Nomura et al., 2006
ventral telencephalon neuron differentiation decreased process quality, abnormal WT + MO1-fgf16 Fig. 6 with image from Miyake et al., 2014
Phenotype of all Fish created by or utilizing MO1-fgf16
Phenotype Fish Conditions Figures
midbrain morphology, abnormal WT + MO1-fgf16 standard conditions Fig. 1 with image from Miyake et al., 2014
oligodendrocyte differentiation disrupted, abnormal WT + MO1-fgf16 standard conditions Fig. 6 with image,  Fig. 7 with image from Miyake et al., 2014
ventral telencephalon neuron differentiation decreased process quality, abnormal WT + MO1-fgf16 standard conditions Fig. 6 with image from Miyake et al., 2014
cell proliferation in forebrain decreased occurrence, abnormal WT + MO1-fgf16 standard conditions Fig. 3 with image from Miyake et al., 2014
mesenchyme pectoral fin cell population proliferation decreased occurrence, abnormal WT + MO1-fgf16 standard conditions Fig. 6 from Nomura et al., 2006
diencephalon neuron differentiation decreased process quality, abnormal WT + MO1-fgf16 standard conditions Fig. 6 with image from Miyake et al., 2014
forebrain development disrupted, abnormal WT + MO1-fgf16 standard conditions Fig. 1 with image from Miyake et al., 2014
pectoral fin development disrupted, abnormal WT + MO1-fgf16 standard conditions Fig. 3 from Nomura et al., 2006
forebrain has fewer parts of type oligodendrocyte, abnormal WT + MO1-fgf16 standard conditions Fig. 6 with image from Miyake et al., 2014
forebrain lacks all parts of type GABAergic neuron, abnormal WT + MO1-fgf16 standard conditions Fig. 7 with image from Miyake et al., 2014
trunk bent, abnormal WT + MO1-fgf16 standard conditions Fig. 3 from Nomura et al., 2006
hindbrain lacks all parts of type oligodendrocyte, abnormal WT + MO1-fgf16 standard conditions Fig. 7 with image from Miyake et al., 2014
forebrain apoptotic process increased occurrence, abnormal WT + MO1-fgf16 standard conditions Fig. S1 with image from Miyake et al., 2014
midbrain hindbrain boundary absent, abnormal WT + MO1-fgf16 standard conditions Fig. 1 with image from Miyake et al., 2014
pectoral fin bud absent, abnormal WT + MO1-fgf16 standard conditions Fig. 3 from Nomura et al., 2006
pectoral fin absent, abnormal WT + MO1-fgf16 standard conditions Fig. 3 from Nomura et al., 2006
midbrain development disrupted, abnormal WT + MO1-fgf16 standard conditions Fig. 1 with image from Miyake et al., 2014
pectoral fin bud decreased size, abnormal WT + MO1-fgf16 standard conditions Fig. 3 from Nomura et al., 2006
forebrain lacks all parts of type oligodendrocyte, abnormal WT + MO1-fgf16 standard conditions Fig. 7 with image from Miyake et al., 2014
forebrain morphology, abnormal WT + MO1-fgf16 standard conditions Fig. 1 with image from Miyake et al., 2014
midbrain apoptotic process increased occurrence, abnormal WT + MO1-fgf16 standard conditions Fig. S1 with image from Miyake et al., 2014
GABAergic neuron differentiation disrupted, abnormal WT + MO1-fgf16 standard conditions Fig. 6 with image,  Fig. 7 with image from Miyake et al., 2014
forebrain has fewer parts of type GABAergic neuron, abnormal WT + MO1-fgf16 standard conditions Fig. 6 with image from Miyake et al., 2014
cell proliferation in midbrain decreased occurrence, abnormal WT + MO1-fgf16 standard conditions Fig. 3 with image from Miyake et al., 2014
GABAergic neuron decreased amount, abnormal WT + MO1-fgf16 standard conditions Fig. 6 with image from Miyake et al., 2014
pectoral fin bud decreased depth, abnormal WT + MO1-fgf16 standard conditions Fig. 3 from Nomura et al., 2006
midbrain-hindbrain boundary development disrupted, abnormal WT + MO1-fgf16 standard conditions Fig. 1 with image from Miyake et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.