header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060719-1
Morpholino Name: MO1-myd88
Target: myd88 (1)
Sequence:
5' - TAGCAAAACCTCTGTTATCCAGCGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: inhibits translation
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-myd88 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-myd88
Expressed Gene Anatomy Figures
cxcl8a Fig. 8 from Stockhammer et al., 2009
cxcl18b Fig. 8 from Stockhammer et al., 2009
defbl1 Fig. 3 with image from Galindo-Villegas et al., 2012
efnb2a Fig. S5 from He et al., 2015
foxn1 Fig. 2 from He et al., 2015
gata1a Fig. S5 from He et al., 2015
ifnphi1 Fig. 8 from Stockhammer et al., 2009
il1b Fig. 3 with imageFig. 5 with image from Galindo-Villegas et al., 2012
Fig. 8 from Stockhammer et al., 2009
irak3 Fig. 8 from Stockhammer et al., 2009
kdrl Fig. S5 from He et al., 2015
lcp1 Fig. S5 from He et al., 2015
Fig. 3 from van der Sar et al., 2006
mmp9 Fig. 8 from Stockhammer et al., 2009
mpx Fig. 3 from van der Sar et al., 2006
rag1 Fig. 2 from He et al., 2015
runx1 Fig. 2Fig. 3 from He et al., 2015
tal1 Fig. S5 from He et al., 2015
PHENOTYPE
Phenotype resulting from MO1-myd88
Phenotype of all Fish created by or utilizing MO1-myd88
OTHER MO1-myd88 MORPHOLINO PAGES No links to external sites
CITATIONS (11)