header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060622-6
Morpholino Name: MO2-atp1b2b
Target: atp1b2b (1)
Previous Name: [b]2bMO-2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTTTGAGAGTAATAAAGAGCTATTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-atp1b2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-atp1b2b No data available
PHENOTYPE
Phenotype resulting from MO2-atp1b2b
No data available

Phenotype of all Fish created by or utilizing MO2-atp1b2b
No data available
Genome Resources:
CITATIONS (1)