header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060606-7
Morpholino Name: MO1-pou1f1
Target: pou1f1 (1)
Sequence:
5' - ACTCTTCATCGGCCACCGTTGTGAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pou1f1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pou1f1
Expressed Gene Anatomy Figures
cga Fig. S1 with image from Nica et al., 2006
pomca Fig. S1 with image from Nica et al., 2006
prl Fig. S1 with image from Nica et al., 2006
PHENOTYPE
Phenotype resulting from MO1-pou1f1
No data available

Phenotype of all Fish created by or utilizing MO1-pou1f1
No data available
Genome Resources:
CITATIONS (2)