header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060524-17
Morpholino Name: MO1-rela
Target: rela (1)
Previous Name: p65 MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCCACTGGTGAAACATTCCGTCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-rela No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-rela
Expressed Gene Anatomy Figures
fabp10a Fig. 4 from Basu et al., 2018
hamp Fig. 4 from Basu et al., 2018
rela Fig. 4 from Liu et al., 2009
snai1a Fig. 5 from Liu et al., 2009
PHENOTYPE
Phenotype resulting from MO1-rela
Phenotype of all Fish created by or utilizing MO1-rela
Genome Resources:
CITATIONS (4)