ZFIN ID: ZDB-MRPHLNO-060523-4
Morpholino Name: MO1-hells
Target: hells (1)
Sequence:
5' - TTTGACAATCCCACTCATTTCAGCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-hells No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-hells No data available
PHENOTYPE
Phenotype resulting from MO1-hells
No data available

Phenotype of all Fish created by or utilizing MO1-hells
No data available
OTHER MO1-hells MORPHOLINO PAGES
  • MODB:574 (2)
  • CITATIONS (3)