ZFIN ID: ZDB-MRPHLNO-060522-5
Morpholino Name: MO1-slc39a9
Target: slc39a9 (1)
Sequence:
5' - TCTGCTGAGCTTCCACCGCTGACTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-slc39a9 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-slc39a9 No data available
PHENOTYPE
Phenotype resulting from MO1-slc39a9
No data available

Phenotype of all Fish created by or utilizing MO1-slc39a9
No data available
OTHER MO1-slc39a9 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)