Morpholino

MO2-ctnnb1

ID

ZDB-MRPHLNO-060414-1

Name

MO2-ctnnb1

Previous Names

b-catenin-1 MO1 (1)

Target

ctnnb1 (1)

Sequence

5' - CTGGGTAGCCATGATTTTCTCACAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

MODB:29 (2)

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-ctnnb1

Expressed Gene	Anatomy	Figures
chrd	(not) axis (not) ectoderm germ ring margin (not) mesoderm (not) whole organism	Fig. 2 from Varga et al., 2007 Fig. 7 from Bellipanni et al., 2006
dharma	margin (not) whole organism	Fig. 5 , Fig. 7 from Bellipanni et al., 2006
egr2b	unspecified	Fig. 6 from Bellipanni et al., 2006
emx1	unspecified	Fig. 6 from Bellipanni et al., 2006
gsc	margin	Fig. 7 from Bellipanni et al., 2006
hoxb6b	unspecified	Fig. 6 from Bellipanni et al., 2006
isl1a	unspecified	Fig. 6 from Bellipanni et al., 2006
myod1	unspecified	Fig. 6 from Bellipanni et al., 2006
ndr1	margin	Fig. 5 , Fig. 7 from Bellipanni et al., 2006
nog1	(not) axial mesoderm germ ring	Fig. 2 from Varga et al., 2007

Phenotype

Phenotype resulting from MO2-ctnnb1

Phenotype	Fish	Figures
head necrotic, abnormal	WT + MO2-ctnnb1	Fig. 4 from Bellipanni et al., 2006
post-vent region curved ventral, abnormal	WT + MO2-ctnnb1	Fig. 4 from Bellipanni et al., 2006
post-vent region decreased length, abnormal	WT + MO2-ctnnb1	Fig. 4 from Bellipanni et al., 2006

Phenotype of all Fish created by or utilizing MO2-ctnnb1

Phenotype	Fish	Conditions	Figures
post-vent region decreased length, abnormal	WT + MO2-ctnnb1	standard conditions	Fig. 4 from Bellipanni et al., 2006
post-vent region curved ventral, abnormal	WT + MO2-ctnnb1	standard conditions	Fig. 4 from Bellipanni et al., 2006
head necrotic, abnormal	WT + MO2-ctnnb1	standard conditions	Fig. 4 from Bellipanni et al., 2006
whole organism morphology, ameliorated	ctnnb2^tpl149/+ + MO1-ctnnb2 + MO2-ctnnb1	standard conditions	Figure 2 from Cunningham et al., 2020
dorsal/ventral axis specification disrupted, abnormal	WT + MO1-ctnnb2 + MO2-ctnnb1	standard conditions	Fig. 6 from Bellipanni et al., 2006
whole organism wholly dorsalized, abnormal	WT + MO1-ctnnb2 + MO2-ctnnb1	standard conditions	Fig. 6 from Bellipanni et al., 2006
whole organism morphology, abnormal	WT + MO1-ctnnb2 + MO2-ctnnb1	standard conditions	Figure 2 from Cunningham et al., 2020
whole organism wholly dorsalized, abnormal	ctnnb2^p1 + MO2-ctnnb1	standard conditions	Fig. 6 from Bellipanni et al., 2006
dorsal/ventral axis specification disrupted, abnormal	ctnnb2^p1 + MO2-ctnnb1	standard conditions	Fig. 6 from Bellipanni et al., 2006
whole organism wholly ventralized, abnormal	brs^b2; ctnnb2^p1/p1 + MO1-ctnnb2 + MO2-ctnnb1	standard conditions	Fig. 3 from Varga et al., 2007
post-vent region morphology, abnormal	brs^b2; ctnnb2^p1/p1 + MO1-ctnnb2 + MO2-ctnnb1	standard conditions	Fig. 3 from Varga et al., 2007
post-vent region morphology, abnormal	brs^b2; ctnnb2^p1/p1 + MO1-chrd + MO1-ctnnb2 + MO2-ctnnb1	standard conditions	Fig. 3 from Varga et al., 2007
whole organism wholly ventralized, abnormal	brs^b2; ctnnb2^p1/p1 + MO1-chrd + MO1-ctnnb2 + MO2-ctnnb1	standard conditions	Fig. 3 from Varga et al., 2007

Citations