header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060411-1
Morpholino Name: MO1-otx1
Target: otx1 (1)
Previous Names: MO1-otx1, MO1-otx1b

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TAACATATAGCCTACCTGAACTCGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets the exon3/intron 3-4 junction.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-otx1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-otx1
Expressed Gene Anatomy Figures
dct Fig. 4 with image from Lane et al., 2012
mitfa Fig. 5 with image from Lane et al., 2012
mitfb Fig. 5 with image from Lane et al., 2012
msx3 Fig. 8 with image from Hammond et al., 2006
PHENOTYPE
Phenotype resulting from MO1-otx1
Phenotype of all Fish created by or utilizing MO1-otx1
Phenotype Fish Conditions Figures
lateral semicircular canal development disrupted, abnormal WIK + MO1-otx1 standard conditions Fig. 8 with image from Hammond et al., 2006
inner ear lacks all parts of type lateral crista, abnormal WIK + MO1-otx1 standard conditions Fig. 8 with image from Hammond et al., 2006
inner ear lacks all parts of type lateral semicircular canal, abnormal WIK + MO1-otx1 standard conditions Fig. 8 with image from Hammond et al., 2006
anterior macula decreased distance posterior macula, abnormal WIK + MO1-otx1 standard conditions Fig. 8 with image from Hammond et al., 2006
retinal pigmented epithelium ventral region absent, abnormal WT + MO1-otx1 + MO1-otx2a standard conditions Fig. 2 with image from Lane et al., 2012
retinal pigmented epithelium anterior side separated from retinal pigmented epithelium posterior side, abnormal WT + MO1-otx1 + MO1-otx2a standard conditions Fig. 2 with image from Lane et al., 2012
eye perforate, abnormal WT + MO1-otx1 + MO1-otx2a standard conditions Fig. 2 with image from Lane et al., 2012
optic fissure closure incomplete, abnormal WT + MO1-otx1 + MO1-otx2a standard conditions Fig. 2 with image from Lane et al., 2012
eye perforate, abnormal WT + MO1-otx1 + MO1-otx2b standard conditions Fig. 2 with image from Lane et al., 2012
optic fissure closure incomplete, abnormal WT + MO1-otx1 + MO1-otx2b standard conditions Fig. 2 with image from Lane et al., 2012
retinal pigmented epithelium anterior side separated from retinal pigmented epithelium posterior side, abnormal WT + MO1-otx1 + MO1-otx2a + MO1-otx2b standard conditions Fig. 2 with image from Lane et al., 2012
retinal pigmented epithelium ventral region absent, abnormal WT + MO1-otx1 + MO1-otx2a + MO1-otx2b standard conditions Fig. 2 with image from Lane et al., 2012
OTHER MO1-otx1 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)