header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060328-2
Morpholino Name: MO1-tbx5a
Target: tbx5a (1)
Previous Names: MO1-tbx5 (1), tbx-MO (1), tbx5 MO (1), tbx5-MO(1) (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GAAAGGTGTCTTCACTGTCCGCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-tbx5a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-tbx5a
Expressed Gene Anatomy Figures
akt2 Fig. 2 with image from Tsai et al., 2012
atp1a2a Fig. 2 from D'Aurizio et al., 2016
badb Fig. 4 with image from Tsai et al., 2012
Fig. 2 with image from Lu et al., 2011
baxa Fig. 2 with image from Lu et al., 2011
bcl2a Fig. 4 with image from Tsai et al., 2012
Fig. 2 with image from Lu et al., 2011
camk2d1 Fig. 2 from D'Aurizio et al., 2016
casp8 Fig. 4 with image from Lu et al., 2011
cdk2 Fig. 5 with image from Tsai et al., 2012
cdkn1bb Fig. 5 with image from Tsai et al., 2012
efnb2a Fig. 4 with image from Pi-Roig et al., 2014
ephb2a Fig. 4 with image from Pi-Roig et al., 2014
fgf24 Fig. 6 with image from Fischer et al., 2003
ghra Fig. 2 with image from Tsai et al., 2012
ghrb Fig. 2 with image from Tsai et al., 2012
hand2 Fig. 2 from D'Aurizio et al., 2016
Fig. 6 from Lu et al., 2008
has2 Fig. 4 from Tong et al., 2014
igf1 Fig. 2 with image from Tsai et al., 2012
Fig. 6 from Lu et al., 2008
mef2aa Fig. 2 from D'Aurizio et al., 2016
mir7b Fig. 2 from D'Aurizio et al., 2016
mir10d Fig. 2 from D'Aurizio et al., 2016
mir19a Fig. 2 from D'Aurizio et al., 2016
mir30a Fig. 2 from D'Aurizio et al., 2016
mir34a Fig. 2 from D'Aurizio et al., 2016
mstnb Fig. 6 from Lu et al., 2008
myh6 Fig. 6 with image from Tsai et al., 2012
Fig. 5Fig. 6 from Lu et al., 2008
myh7 Fig. 6 with image from Tsai et al., 2012
Fig. 5Fig. 6 from Lu et al., 2008
myl7 Fig. 2 with image from Pi-Roig et al., 2014
Fig. 6 with image from Tsai et al., 2012
Fig. 1 with image from Lou et al., 2011
Fig. 5Fig. 6 from Lu et al., 2008
myod1 Fig. 6 from Lu et al., 2008
ndrg4 Fig. 2 from D'Aurizio et al., 2016
Fig. 9 with image from Qu et al., 2008
nkx2.5 Fig. 1 with image from Lou et al., 2011
Fig. 6 from Lu et al., 2008
prdm1a Fig. 5 with image from Lee et al., 2006
robo1 Fig. 2 from D'Aurizio et al., 2016
sall1a Fig. 4 with image from Harvey et al., 2006
sall4 Fig. 2 with image from Harvey et al., 2006
srfa Fig. 2 from D'Aurizio et al., 2016
tbx5a Fig. 6 from Lu et al., 2008
Fig. 2 with image from Harvey et al., 2006
PHENOTYPE
Phenotype resulting from MO1-tbx5a
Phenotype Figures
apoptotic process increased occurrence, abnormal Fig. 3 with image from Tsai et al., 2012
Fig. 1 with image from Lu et al., 2011
atrium myh6 expression decreased amount, abnormal Fig. 6 with image from Tsai et al., 2012
atrium morphology, abnormal Fig. 4 from Ghosh et al., 2017
atrium size, abnormal Fig. 4 from Ghosh et al., 2017
cardiac muscle cell bicellular tight junction dissociated from cardiac muscle cell bicellular tight junction, abnormal Fig. 7 with image from Lu et al., 2011
cardiac muscle cell mitochondrion increased amount, abnormal Fig. 7 with image from Lu et al., 2011
cardiac muscle cell mitochondrion swollen, abnormal Fig. 7 with image from Lu et al., 2011
cardiac ventricle myl7 expression decreased amount, abnormal Fig. 6 with image from Tsai et al., 2012
cardiac ventricle myh7 expression decreased amount, abnormal Fig. 6 with image from Tsai et al., 2012
cardiac ventricle decreased contractility, abnormal Fig. 1 with image from Tsai et al., 2012
cardiac ventricle morphology, abnormal Fig. 4 from Ghosh et al., 2017
cardiac ventricle size, abnormal Fig. 4 from Ghosh et al., 2017
fin agenesis, abnormal Fig. S8 with image from Chiavacci et al., 2012
heart decreased size, abnormal Fig. 4 from Tong et al., 2014
Fig. 2 from Lu et al., 2008
heart edematous, abnormal Fig. 1 with image from Tsai et al., 2012
heart malformed, abnormal Fig. 1 with image from Pi-Roig et al., 2014
Fig. 1 with image from Lu et al., 2011
heart morphology, abnormal Fig. 4 from Ghosh et al., 2017
Fig. 2 with image from Chiavacci et al., 2015
Fig. 6 from Li et al., 2014
Fig. 1 with image from Tsai et al., 2012
Fig. 1Fig. 2Fig. 5 from Lu et al., 2008
Fig. 9 with image from Qu et al., 2008
heart contraction decreased rate, abnormal Fig. 4 from Ghosh et al., 2017
heart development disrupted, abnormal Fig. 2 with image from Chiavacci et al., 2015
Fig. 9 with image from Qu et al., 2008
heart jogging disrupted, abnormal Fig. 2 with image from Pi-Roig et al., 2014
heart looping arrested, abnormal Fig. 1 with image from Pi-Roig et al., 2014
Fig. 4 with image from Garrity et al., 2002
heart looping disrupted, abnormal Fig. 1 with image from Pi-Roig et al., 2014
Fig. 1 with image from Lu et al., 2011
Fig. 6 from Ghosh et al., 2009
Fig. 1Fig. 2Fig. 5 from Lu et al., 2008
heart looping process quality, abnormal Fig. 4 from Ghosh et al., 2017
heart tube linear, abnormal Fig. 4 with image from Garrity et al., 2002
myocardium disorganized, abnormal Fig. 7 with image from Lu et al., 2011
myocardium myofibril disorganized, abnormal Fig. 7 with image from Lu et al., 2011
paired fin absent, abnormal Fig. 6 from Ghosh et al., 2017
paired fin decreased size, abnormal Fig. 6 from Ghosh et al., 2017
paired fin morphology, abnormal Fig. 6 from Ghosh et al., 2017
pectoral fin absent, abnormal Fig. 4 with image from Garrity et al., 2002
pectoral fin aplastic, abnormal Fig. 5 with image from Pi-Roig et al., 2014
Fig. 1 with image from Tsai et al., 2012
Fig. 6 from Ghosh et al., 2009
pectoral fin hypoplastic, abnormal Fig. 1 with image from Lu et al., 2011
pectoral fin morphology, abnormal Fig. 2 with image from Chiavacci et al., 2015
Fig. 6 from Li et al., 2014
pectoral fin truncated, abnormal Fig. 1 with image from Tsai et al., 2012
pectoral fin upturned, abnormal Fig. 4 with image from Garrity et al., 2002
pectoral fin bud absent, abnormal Fig. 6 with image from Fischer et al., 2003
pectoral fin development disrupted, abnormal Fig. 5 with image from Pi-Roig et al., 2014
pericardium edematous, abnormal Fig. 4 from Ghosh et al., 2017
Fig. S8 with image from Chiavacci et al., 2012
Fig. 6 from Ghosh et al., 2009
Fig. 1Fig. 2 from Lu et al., 2008
somite U-shaped, abnormal Fig. 6 from Li et al., 2014
Fig. 1 with image from Tsai et al., 2012
trunk bent, abnormal Fig. 1 with image from Tsai et al., 2012
trunk curled, abnormal Fig. 1 with image from Lu et al., 2011
trunk decreased length, abnormal Fig. 1 with image from Lu et al., 2011
whole organism dead, abnormal Fig. 2 with image from Chiavacci et al., 2015
whole organism ghra expression decreased amount, abnormal Fig. 2 with image from Tsai et al., 2012
whole organism ghrb expression decreased amount, abnormal Fig. 2 with image from Tsai et al., 2012
whole organism akt2 expression decreased amount, abnormal Fig. 2 with image from Tsai et al., 2012
whole organism igf1 expression decreased amount, abnormal Fig. 2 with image from Tsai et al., 2012
whole organism robo1 expression increased amount, abnormal Fig. 2 from D'Aurizio et al., 2016
whole organism mef2aa expression increased amount, abnormal Fig. 2 from D'Aurizio et al., 2016
whole organism mir7b expression increased amount, abnormal Fig. 2 from D'Aurizio et al., 2016
whole organism camk2d1 expression increased amount, abnormal Fig. 2 from D'Aurizio et al., 2016
whole organism cdkn1bb expression increased amount, abnormal Fig. 5 with image from Tsai et al., 2012
whole organism bcl2a expression increased amount, abnormal Fig. 4 with image from Tsai et al., 2012
whole organism mir19a expression increased amount, abnormal Fig. 2 from D'Aurizio et al., 2016
whole organism srfa expression increased amount, abnormal Fig. 2 from D'Aurizio et al., 2016
whole organism badb expression increased amount, abnormal Fig. 4 with image from Tsai et al., 2012
whole organism atp1a2a expression increased amount, abnormal Fig. 2 from D'Aurizio et al., 2016
whole organism mir34a expression increased amount, abnormal Fig. 2 from D'Aurizio et al., 2016
whole organism ndrg4 expression increased amount, abnormal Fig. 2 from D'Aurizio et al., 2016
whole organism hand2 expression increased amount, abnormal Fig. 2 from D'Aurizio et al., 2016
whole organism mir10d expression increased amount, abnormal Fig. 2 from D'Aurizio et al., 2016
whole organism mir30a expression increased amount, abnormal Fig. 2 from D'Aurizio et al., 2016
whole organism cdk2 expression increased amount, abnormal Fig. 5 with image from Tsai et al., 2012
whole organism lacks parts or has fewer parts of type pectoral fin, abnormal Fig. 4 with image from Garrity et al., 2002
whole organism semi-lethal (sensu genetics), abnormal Fig. 2 from Lu et al., 2008

Phenotype of all Fish created by or utilizing MO1-tbx5a
Phenotype Fish Conditions Figures
whole organism camk2d1 expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism mir34a expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism mir30a expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism atp1a2a expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism hand2 expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism mef2aa expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism mir19a expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism robo1 expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism ndrg4 expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism mir10d expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism srfa expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism mir7b expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
atrium myh6 expression decreased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 6 with image from Tsai et al., 2012
trunk bent, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Tsai et al., 2012
whole organism badb expression amount, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 4 with image from Tsai et al., 2012
cardiac ventricle decreased contractility, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Tsai et al., 2012
somite U-shaped, abnormal WT + MO1-tbx5a standard conditions Fig. 6 from Li et al., 2014
Fig. 1 with image from Tsai et al., 2012
heart morphology, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 6 from Li et al., 2014
cardiac ventricle morphology, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
whole organism ghra expression decreased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 2 with image from Tsai et al., 2012
paired fin morphology, abnormal WT + MO1-tbx5a standard conditions Fig. 6 from Ghosh et al., 2017
myocardium disorganized, abnormal WT + MO1-tbx5a standard conditions Fig. 7 with image from Lu et al., 2011
cardiac ventricle myl7 expression amount, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 6 with image from Tsai et al., 2012
heart decreased size, abnormal WT + MO1-tbx5a standard conditions Fig. 2 from Lu et al., 2008
heart malformed, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Pi-Roig et al., 2014
Fig. 1 with image from Lu et al., 2011
cardiac ventricle myh7 expression decreased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 6 with image from Tsai et al., 2012
paired fin absent, abnormal WT + MO1-tbx5a standard conditions Fig. 6 from Ghosh et al., 2017
pectoral fin morphology, abnormal WT + MO1-tbx5a standard conditions Fig. 6 from Li et al., 2014
trunk decreased length, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Lu et al., 2011
cardiac muscle cell bicellular tight junction dissociated from cardiac muscle cell bicellular tight junction, abnormal WT + MO1-tbx5a standard conditions Fig. 7 with image from Lu et al., 2011
cardiac ventricle size, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
trunk curled, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Lu et al., 2011
atrium morphology, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
heart morphology, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
Fig. 6 from Li et al., 2014
Fig. 1 with image from Tsai et al., 2012
Fig. 1Fig. 2Fig. 5 from Lu et al., 2008
Fig. 9 with image from Qu et al., 2008
whole organism cdkn1bb expression amount, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 5 with image from Tsai et al., 2012
cardiac muscle cell mitochondrion increased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 7 with image from Lu et al., 2011
pectoral fin bud absent, abnormal WT + MO1-tbx5a standard conditions Fig. 6 with image from Fischer et al., 2003
paired fin decreased size, abnormal WT + MO1-tbx5a standard conditions Fig. 6 from Ghosh et al., 2017
cardiac ventricle myl7 expression decreased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 6 with image from Tsai et al., 2012
pectoral fin upturned, abnormal WT + MO1-tbx5a standard conditions Fig. 4 with image from Garrity et al., 2002
heart looping arrested, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Pi-Roig et al., 2014
Fig. 4 with image from Garrity et al., 2002
whole organism cdk2 expression amount, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 5 with image from Tsai et al., 2012
whole organism bcl2a expression increased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 4 with image from Tsai et al., 2012
cardiac ventricle myh7 expression amount, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 6 with image from Tsai et al., 2012
pericardium edematous, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
Fig. 6 from Ghosh et al., 2009
Fig. 1Fig. 2 from Lu et al., 2008
whole organism ghrb expression decreased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 2 with image from Tsai et al., 2012
whole organism cdkn1bb expression increased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 5 with image from Tsai et al., 2012
somite shape, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 6 from Li et al., 2014
cardiac muscle cell mitochondrion swollen, abnormal WT + MO1-tbx5a standard conditions Fig. 7 with image from Lu et al., 2011
pectoral fin aplastic, abnormal WT + MO1-tbx5a standard conditions Fig. 5 with image from Pi-Roig et al., 2014
Fig. 1 with image from Tsai et al., 2012
Fig. 6 from Ghosh et al., 2009
heart development disrupted, abnormal WT + MO1-tbx5a standard conditions Fig. 9 with image from Qu et al., 2008
heart edematous, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Tsai et al., 2012
pectoral fin hypoplastic, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Lu et al., 2011
pectoral fin truncated, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Tsai et al., 2012
whole organism semi-lethal (sensu genetics), abnormal WT + MO1-tbx5a standard conditions Fig. 2 from Lu et al., 2008
atrium size, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
whole organism cdk2 expression increased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 5 with image from Tsai et al., 2012
heart jogging disrupted, abnormal WT + MO1-tbx5a standard conditions Fig. 2 with image from Pi-Roig et al., 2014
heart contraction decreased rate, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
whole organism lacks parts or has fewer parts of type pectoral fin, abnormal WT + MO1-tbx5a standard conditions Fig. 4 with image from Garrity et al., 2002
whole organism badb expression increased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 4 with image from Tsai et al., 2012
heart looping disrupted, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Pi-Roig et al., 2014
Fig. 1 with image from Lu et al., 2011
Fig. 6 from Ghosh et al., 2009
Fig. 1Fig. 2Fig. 5 from Lu et al., 2008
pectoral fin development disrupted, abnormal WT + MO1-tbx5a standard conditions Fig. 5 with image from Pi-Roig et al., 2014
whole organism igf1 expression decreased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 2 with image from Tsai et al., 2012
apoptotic process occurrence, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 3 with image from Tsai et al., 2012
pectoral fin absent, abnormal WT + MO1-tbx5a standard conditions Fig. 4 with image from Garrity et al., 2002
atrium myh6 expression amount, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 6 with image from Tsai et al., 2012
heart tube linear, abnormal WT + MO1-tbx5a standard conditions Fig. 4 with image from Garrity et al., 2002
apoptotic process increased occurrence, abnormal WT + MO1-tbx5a standard conditions Fig. 3 with image from Tsai et al., 2012
Fig. 1 with image from Lu et al., 2011
myocardium myofibril disorganized, abnormal WT + MO1-tbx5a standard conditions Fig. 7 with image from Lu et al., 2011
pectoral fin morphology, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 6 from Li et al., 2014
heart looping process quality, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
whole organism akt2 expression decreased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 2 with image from Tsai et al., 2012
whole organism bcl2a expression amount, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 4 with image from Tsai et al., 2012
heart decreased size, abnormal f1Tg + MO1-tbx5a standard conditions Fig. 4 from Tong et al., 2014
heart morphology, abnormal twu34Tg + MO1-tbx5a standard conditions Fig. 2 with image from Chiavacci et al., 2015
heart development disrupted, abnormal twu34Tg + MO1-tbx5a standard conditions Fig. 2 with image from Chiavacci et al., 2015
whole organism dead, abnormal twu34Tg + MO1-tbx5a standard conditions Fig. 2 with image from Chiavacci et al., 2015
pectoral fin morphology, abnormal twu34Tg + MO1-tbx5a standard conditions Fig. 2 with image from Chiavacci et al., 2015
pericardium edematous, abnormal s849Tg; uto1Tg + MO1-tbx5a standard conditions Fig. S8 with image from Chiavacci et al., 2012
fin agenesis, abnormal s849Tg; uto1Tg + MO1-tbx5a standard conditions Fig. S8 with image from Chiavacci et al., 2012
heart morphology, abnormal s958Tg ; s957Tg + MO1-tbx5a control Fig. 4 with image from Wang et al., 2017
heart edematous, abnormal s958Tg ; s957Tg + MO1-tbx5a control Fig. 4 with image from Wang et al., 2017
heart looping arrested, abnormal s958Tg ; s957Tg + MO1-tbx5a control Fig. 4 with image from Wang et al., 2017
heart development process quality, abnormal s958Tg ; s957Tg + MO1-tbx5a control Fig. 4 with image from Wang et al., 2017
fin absent, abnormal AB + MO1-tbx5a + MO2-tbx5b standard conditions Fig. 1 with image from Chiavacci et al., 2015
heart morphology, abnormal AB + MO1-tbx5a + MO2-tbx5b standard conditions Fig. 1 with image from Chiavacci et al., 2015
fin morphology, abnormal AB + MO1-tbx5a + MO2-tbx5b standard conditions Fig. 1 with image from Chiavacci et al., 2015
heart looping disrupted, abnormal TL + MO1-tbx5a + MO3-atoh8 standard conditions Fig. 3 from Rawnsley et al., 2013
heart tube shape, abnormal TL + MO1-tbx5a + MO3-atoh8 standard conditions Fig. 3 from Rawnsley et al., 2013
heart tube bifurcated, abnormal WT + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart morphogenesis disrupted, abnormal WT + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell differentiation disrupted, abnormal WT + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell decreased amount, abnormal WT + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart morphology, abnormal WT + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart morphogenesis disrupted, abnormal WT + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart jogging disrupted, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 2 with image from Pi-Roig et al., 2014
heart looping disrupted, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 1 with image from Pi-Roig et al., 2014
cranial nerve II decreased thickness, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 4 with image from Pi-Roig et al., 2014
heart malformed, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 1 with image from Pi-Roig et al., 2014
heart looping arrested, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 1 with image from Pi-Roig et al., 2014
heart looping disrupted, abnormal WT + MO1-tbx5a + MO5-mef2ca standard conditions Fig. 6Fig. 7 from Ghosh et al., 2009
pericardium edematous, abnormal WT + MO1-tbx5a + MO5-mef2ca standard conditions Fig. 6 from Ghosh et al., 2009
heart morphogenesis arrested, abnormal WT + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell differentiation disrupted, abnormal WT + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart tube bifurcated, abnormal WT + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell decreased amount, abnormal WT + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell differentiation disrupted, abnormal twu34Tg + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart bifurcated, abnormal twu34Tg + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart morphogenesis disrupted, abnormal twu34Tg + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart looping disrupted, abnormal twu34Tg + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart development disrupted, abnormal twu34Tg + MO1-tbx5a + MO2-mir19a standard conditions Fig. 4 with image from Chiavacci et al., 2015
heart morphology, abnormal twu34Tg + MO1-tbx5a + MO2-mir19a standard conditions Fig. 4 with image from Chiavacci et al., 2015
fin morphology, abnormal twu34Tg + MO1-tbx5a + MO2-mir19a standard conditions Fig. 4 with image from Chiavacci et al., 2015
heart morphology, abnormal twu34Tg + MO1-tbx5a + MO2-tbx5b standard conditions Fig. 1 with image from Chiavacci et al., 2015
heart morphology, abnormal el133Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. S1 with image from Lou et al., 2011
pharyngeal musculature morphology, abnormal el133Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. S1 with image from Lou et al., 2011
endocardium aplastic, abnormal s843Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. S1 with image from Lou et al., 2011
cardiac muscle cell differentiation disrupted, abnormal twu34Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart morphogenesis disrupted, abnormal twu34Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart bifurcated, abnormal twu34Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
OTHER MO1-tbx5a MORPHOLINO PAGESNo links to external sites
CITATIONS (26)