header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060220-1
Morpholino Name: MO1-dmd
Target: dmd (1)
Sequence:
5' - TTGAGTCCTTTAATCCTACAATTTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This morpholino has a 1 bp mismatch to Ensembl sequence, which may be due to a polymorphism. Correspondence with author Guyon indicates that the published sequence of the morpholino is correct and that it matches the sequence of their cDNA.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-dmd No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-dmd
Expressed Gene Anatomy Figures
dmd Fig. 6 with image from Ruf-Zamojski et al., 2015
PHENOTYPE
Phenotype resulting from MO1-dmd
Phenotype of all Fish created by or utilizing MO1-dmd
Genome Resources:
CITATIONS (6)