Morpholino

MO6-wnt8a

ID
ZDB-MRPHLNO-060130-10
Name
MO6-wnt8a
Previous Names
  • orf2 exon3 MO (1)
Target
Sequence
5' - CTTATGAATATCTTACCACTTCTCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-wnt8a
No data available
Phenotype
Phenotype resulting from MO6-wnt8a
No data available
Phenotype of all Fish created by or utilizing MO6-wnt8a
Phenotype Fish Conditions Figures
axis decreased length, abnormal AB + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a standard conditions Fig. 1 with image from Ramel et al., 2005
notochord development disrupted, abnormal AB + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a standard conditions Fig. 1 with image from Ramel et al., 2005
notochord structure, abnormal AB + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a standard conditions Fig. 1 with image from Ramel et al., 2005
post-vent region mesoderm decreased size, abnormal AB + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a standard conditions Fig. 1 with image from Ramel et al., 2005
trunk mesoderm decreased size, abnormal AB + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a standard conditions Fig. 1 with image from Ramel et al., 2005
notochord increased width, abnormal AB + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a standard conditions Fig. 1 with image from Ramel et al., 2005
axis mislocalised posteriorly, abnormal AB + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a standard conditions Fig. 1 with image from Ramel et al., 2005
mesoderm formation disrupted, abnormal AB + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a standard conditions Fig. 1 with image from Ramel et al., 2005
axis decreased length, abnormal bmp2btc300a/+ + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a (TU) standard conditions Fig. 1 with image from Ramel et al., 2005
convergent extension involved in gastrulation disrupted, abnormal bmp2btc300a/+ + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a (TU) standard conditions Fig. 1 with image from Ramel et al., 2005
axis mislocalised posteriorly, abnormal bmp2btc300a/+ + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a (TU) standard conditions Fig. 1 with image from Ramel et al., 2005
notochord morphology, abnormal bmp2btc300a/+ + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a (TU) standard conditions Fig. 1 with image from Ramel et al., 2005
mesoderm formation disrupted, abnormal bmp2btc300a/+ + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a (TU) standard conditions Fig. 1 with image from Ramel et al., 2005
whole organism elongated, abnormal bmp2btc300a/tc300a + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a (TU) standard conditions Fig. 1 with image from Ramel et al., 2005
whole organism morphology, abnormal bmp2btc300a/tc300a + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a (TU) standard conditions Fig. 1 with image from Ramel et al., 2005
dorsal/ventral pattern formation disrupted, abnormal bmp2btc300a/tc300a + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a (TU) standard conditions Fig. 1 with image from Ramel et al., 2005
polarity specification of dorsal/ventral axis disrupted, abnormal bmp2btc300a/tc300a + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a (TU) standard conditions Fig. 1 with image from Ramel et al., 2005
Citations