ZFIN ID: ZDB-MRPHLNO-060111-6
Morpholino Name: MO1-pitpnaa
Target: pitpnaa (1)
Previous Name: MO1-pitpna

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CATGTTATCTCCTTTGCCGCCCCGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pitpnaa No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pitpnaa
Expressed Gene Anatomy Figures
pitpnaa Fig. 2 with image from Vieira et al., 2017
PHENOTYPE
Phenotype resulting from MO1-pitpnaa
Phenotype Figures
axonogenesis disrupted, abnormal Fig. 5 from Xie et al., 2005
CaP motoneuron axon decreased amount, abnormal Fig. 5 from Xie et al., 2005
embryo development arrested, abnormal Fig. 8 from Ile et al., 2010
neuron projection development disrupted, abnormal Fig. 5 from Xie et al., 2005
spinal cord sensory neuron decreased amount, abnormal Fig. 5 from Xie et al., 2005

Phenotype of all Fish created by or utilizing MO1-pitpnaa
Phenotype Fish Conditions Figures
CaP motoneuron axon decreased amount, abnormal WT + MO1-pitpnaa standard conditions Fig. 5 from Xie et al., 2005
neuron projection development disrupted, abnormal WT + MO1-pitpnaa standard conditions Fig. 5 from Xie et al., 2005
spinal cord sensory neuron decreased amount, abnormal WT + MO1-pitpnaa standard conditions Fig. 5 from Xie et al., 2005
axonogenesis disrupted, abnormal WT + MO1-pitpnaa standard conditions Fig. 5 from Xie et al., 2005
embryo development arrested, abnormal WT + MO1-pitpnaa standard conditions Fig. 8 from Ile et al., 2010
myotome sarcomere morphology, ameliorated dmdta222a/ta222a + MO1-pitpnaa standard conditions Fig. 3 with image from Vieira et al., 2017
myotome skeletal myofibril assembly process quality, ameliorated dmdta222a/ta222a + MO1-pitpnaa standard conditions Fig. 3 with image from Vieira et al., 2017
whole organism ab1-ptena labeling decreased amount, abnormal dmdta222a/ta222a + MO1-pitpnaa standard conditions Fig. 2 with image from Vieira et al., 2017
myotome skeletal muscle cell ab-f59 labeling spatial pattern, ameliorated dmdta222a/ta222a + MO1-pitpnaa standard conditions Fig. 3 with image from Vieira et al., 2017
swimming occurrence, ameliorated dmdta222a/ta222a + MO1-pitpnaa standard conditions Fig. 3 with image from Vieira et al., 2017
whole organism pitpnaa expression decreased amount, abnormal dmdta222a/ta222a + MO1-pitpnaa standard conditions Fig. 2 with image from Vieira et al., 2017
whole organism ab5-akt labeling increased amount, abnormal dmdta222a/ta222a + MO1-pitpnaa standard conditions Fig. 2 with image from Vieira et al., 2017
OTHER MO1-pitpnaa MORPHOLINO PAGESNo links to external sites
CITATIONS (3)