header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-051221-7
Morpholino Name: MO5-tal1
Target: tal1 (1)
Previous Name: scl ex 2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AAAGCGGCGTTACCTGTTAATAGTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-tal1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-tal1
Expressed Gene Anatomy Figures
drl Fig. 5Fig. 6 from Juarez et al., 2005
gata1a Fig. 6 from Juarez et al., 2005
ikzf1 Fig. 4 from Juarez et al., 2005
lcp1 Fig. 5 from Juarez et al., 2005
lyz Fig. 5 from Juarez et al., 2005
myb Fig. 4 from Juarez et al., 2005
slc4a1a Fig. 6 from Juarez et al., 2005
spi1b Fig. 5 from Juarez et al., 2005
tal1 Fig. 2 from Juarez et al., 2005
PHENOTYPE
Phenotype resulting from MO5-tal1
No data available

Phenotype of all Fish created by or utilizing MO5-tal1
Phenotype Fish Conditions Figures
endocardium decreased anterior-posterior diameter, abnormal WT + MO5-tal1 + MO6-tal1 standard conditions Fig. 3 with image from Schumacher et al., 2013
endocardium morphogenesis decreased process quality, abnormal WT + MO5-tal1 + MO6-tal1 standard conditions Fig. 3 with image from Schumacher et al., 2013
endocardium aggregated, abnormal WT + MO5-tal1 + MO6-tal1 standard conditions Fig. 3 with image from Schumacher et al., 2013
presumptive endocardium morphogenesis of an epithelial sheet decreased process quality, abnormal WT + MO5-tal1 + MO6-tal1 standard conditions Fig. 3 with image from Schumacher et al., 2013
ventricular endocardium aggregated, abnormal WT + MO5-tal1 + MO6-tal1 standard conditions Fig. 3 with image from Schumacher et al., 2013
endocardium cell-cell junction mislocalised, abnormal zn1Tg + MO5-tal1 + MO6-tal1 standard conditions Fig. 5 with imageFig. 6 with image from Schumacher et al., 2013
endocardium endothelial cell obtuse, abnormal zn1Tg + MO5-tal1 + MO6-tal1 standard conditions Fig. 4 with imageFig. 5 with image from Schumacher et al., 2013
presumptive endocardium morphogenesis of an epithelial sheet decreased process quality, abnormal zn1Tg + MO5-tal1 + MO6-tal1 standard conditions Fig. 4 with image from Schumacher et al., 2013
endocardium endothelial cell aggregated, abnormal zn1Tg + MO5-tal1 + MO6-tal1 standard conditions Fig. 4 with image from Schumacher et al., 2013
endocardium cell-cell junction organization decreased process quality, abnormal zn1Tg + MO5-tal1 + MO6-tal1 standard conditions Fig. 5 with imageFig. 6 with image from Schumacher et al., 2013
ventricular endocardium aggregated, abnormal sd12Tg; y7Tg + MO5-tal1 + MO6-tal1(AB) standard conditions Fig. 1 with image from Schumacher et al., 2013
endocardium cardiac muscle cell differentiation process quality, abnormal sd12Tg; y7Tg + MO5-tal1 + MO6-tal1(AB) standard conditions Fig. 5 with imageFig. 7 with imageFig. 8 with image from Schumacher et al., 2013
endocardium morphogenesis decreased process quality, abnormal sd12Tg; y7Tg + MO5-tal1 + MO6-tal1(AB) standard conditions Fig. 1 with image from Schumacher et al., 2013
atrium lacks all parts of type ventricular endocardium, abnormal sd12Tg; y7Tg + MO5-tal1 + MO6-tal1(AB) standard conditions Fig. 1 with image from Schumacher et al., 2013
OTHER MO5-tal1 MORPHOLINO PAGES No links to external sites
CITATIONS (4)