header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-051216-4
Morpholino Name: MO1-vps33a
Target: vps33a (1)
Previous Name: MO vps33a-ATG (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TACCGCAAAACAAATGTGACGCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-vps33a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-vps33a No data available
PHENOTYPE
Phenotype resulting from MO1-vps33a
No data available

Phenotype of all Fish created by or utilizing MO1-vps33a
No data available
OTHER MO1-vps33a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)