header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-051215-2
Morpholino Name: MO2-onecut1
Target: onecut1 (1)
Previous Name: B-point hnf-6 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGTCTGACTTTTGCATATCGACATT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-onecut1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-onecut1 No data available
PHENOTYPE
Phenotype resulting from MO2-onecut1
Phenotype of all Fish created by or utilizing MO2-onecut1
Phenotype Fish Conditions Figures
liver and biliary system decreased functionality, abnormal WT + MO2-onecut1 standard conditions Fig. 7 with image from Matthews et al., 2004
bile ductule aplastic, abnormal WT + MO2-onecut1 standard conditions Fig. 6 with image from Matthews et al., 2004
bile ductule decreased amount, abnormal WT + MO2-onecut1 standard conditions Fig. 6 with image from Matthews et al., 2004
lipid metabolic process process quality, abnormal WT + MO2-onecut1 standard conditions Fig. 7 with image from Matthews et al., 2004
eye decreased size, abnormal WT + MO2-onecut1 standard conditions Fig. 6 with image from Matthews et al., 2004
head increased size, abnormal WT + MO2-onecut1 standard conditions Fig. 6 with image from Matthews et al., 2004
bile ductule obstructed, abnormal WT + MO2-onecut1 standard conditions Fig. 7 with image from Matthews et al., 2004
intrahepatic bile duct distributed, abnormal WT + MO2-onecut1 standard conditions Fig. 6 with image from Matthews et al., 2004
intrahepatic bile duct dilated, abnormal WT + MO2-onecut1 standard conditions Fig. 6 with image from Matthews et al., 2004
bile ductule lumenized, abnormal WT + MO2-onecut1 standard conditions Fig. 7 with image from Matthews et al., 2004
bile ductule dilated, abnormal WT + MO2-onecut1 standard conditions Fig. 7 with image from Matthews et al., 2004
intrahepatic bile duct length, abnormal WT + MO2-onecut1 standard conditions Fig. 6 with image from Matthews et al., 2004
intrahepatic bile duct decreased thickness, abnormal WT + MO2-onecut1 standard conditions Fig. 6 with image from Matthews et al., 2004
OTHER MO2-onecut1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)