Morpholino

MO2-vegfc

ID

ZDB-MRPHLNO-051212-3

Name

MO2-vegfc

Previous Names

None

Target

vegfc (1)

Sequence

5' - AGACAGAAAATCCAAATAAGTGCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-vegfc

No data available

Phenotype

Phenotype resulting from MO2-vegfc

Phenotype	Fish	Figures
cranial blood vessel lacks all parts of type primordial hindbrain channel, abnormal	y1Tg + MO2-vegfc	Fig. 2 from Cohen et al., 2020
lymphangiogenesis disrupted, abnormal	y1Tg + MO2-vegfc	Fig. 2 from Yaniv et al., 2007
posterior cardinal vein vascular sprouts decreased amount, abnormal	y1Tg + MO2-vegfc	Fig. 2 from Cermenati et al., 2013
primordial hindbrain channel angiogenesis decreased process quality, abnormal	y1Tg + MO2-vegfc	Fig. 2 from Cohen et al., 2020
thoracic duct aplastic, abnormal	y1Tg + MO2-vegfc	Fig. 2 from Yaniv et al., 2007
thoracic duct lymphangiogenesis decreased process quality, abnormal	y1Tg + MO2-vegfc	Fig. 4 from Cohen et al., 2020
trunk has fewer parts of type vascular lymphangioblast, abnormal	y1Tg + MO2-vegfc	Fig. 3 from Cohen et al., 2020
trunk lacks all parts of type thoracic duct, abnormal	y1Tg + MO2-vegfc	Fig. 4 from Cohen et al., 2020
trunk lymphatic endothelial cell differentiation decreased occurrence, abnormal	y1Tg + MO2-vegfc	Fig. 3 from Cohen et al., 2020
vascular lymphangioblast decreased amount, abnormal	y1Tg + MO2-vegfc	Fig. 2 from Cermenati et al., 2013

Phenotype of all Fish created by or utilizing MO2-vegfc

Phenotype	Fish	Conditions	Figures
lymphangiogenesis disrupted, abnormal	WT + MO1-vegfc + MO2-vegfc	standard conditions	Fig. 2 from Hogan et al., 2009
lymphangiogenesis disrupted, abnormal	hu4453Tg + MO1-vegfc + MO2-vegfc	standard conditions	Fig. 2 from Hogan et al., 2009
trunk lymph vasculature aplastic, abnormal	hu4453Tg + MO1-vegfc + MO2-vegfc	standard conditions	Fig. 2 from Hogan et al., 2009
lymphangiogenesis disrupted, abnormal	y1Tg + MO1-vegfc + MO2-vegfc	standard conditions	Fig. 2 from Hogan et al., 2009
lymphangiogenesis disrupted, abnormal	y1Tg + MO2-vegfc	standard conditions	Fig. 2 from Yaniv et al., 2007
thoracic duct lymphangiogenesis decreased process quality, abnormal	y1Tg + MO2-vegfc	standard conditions	Fig. 4 from Cohen et al., 2020
trunk lacks all parts of type thoracic duct, abnormal	y1Tg + MO2-vegfc	standard conditions	Fig. 4 from Cohen et al., 2020
primordial hindbrain channel angiogenesis decreased process quality, abnormal	y1Tg + MO2-vegfc	standard conditions	Fig. 2 from Cohen et al., 2020
vascular lymphangioblast decreased amount, abnormal	y1Tg + MO2-vegfc	standard conditions	Fig. 2 from Cermenati et al., 2013
posterior cardinal vein vascular sprouts decreased amount, abnormal	y1Tg + MO2-vegfc	standard conditions	Fig. 2 from Cermenati et al., 2013
trunk lymphatic endothelial cell differentiation decreased occurrence, abnormal	y1Tg + MO2-vegfc	standard conditions	Fig. 3 from Cohen et al., 2020
trunk has fewer parts of type vascular lymphangioblast, abnormal	y1Tg + MO2-vegfc	standard conditions	Fig. 3 from Cohen et al., 2020
cranial blood vessel lacks all parts of type primordial hindbrain channel, abnormal	y1Tg + MO2-vegfc	standard conditions	Fig. 2 from Cohen et al., 2020
thoracic duct aplastic, abnormal	y1Tg + MO2-vegfc	standard conditions	Fig. 2 from Yaniv et al., 2007
artery aplastic, abnormal	y1Tg + MO1-vegfc + MO2-vegfc + MO3-plcg1	standard conditions	Fig. 2 from Hogan et al., 2009
lymphangiogenesis disrupted, abnormal	y1Tg + MO1-vegfc + MO2-vegfc + MO3-plcg1	standard conditions	Fig. 2 from Hogan et al., 2009
intersegmental vessel aplastic, abnormal	y1Tg + MO1-vegfc + MO2-vegfc + MO3-plcg1	standard conditions	Fig. 2 from Hogan et al., 2009
posterior cardinal vein intersegmental vein decreased amount, abnormal	y1Tg + MO2-vegfc + MO7-sox18	standard conditions	Fig. 5 from Cermenati et al., 2013
thoracic duct aplastic, abnormal	y1Tg + MO2-vegfc + MO7-sox18	standard conditions	Fig. 4 from Cermenati et al., 2013
trunk intersegmental vein decreased amount, abnormal	y1Tg + MO2-vegfc + MO7-sox18	standard conditions	Fig. 5 from Cermenati et al., 2013
posterior cardinal vein vascular lymphangioblast decreased amount, abnormal	y1Tg + MO2-vegfc + MO7-sox18	standard conditions	Fig. 5, Fig. 6 from Cermenati et al., 2013
horizontal myoseptum vascular lymphangioblast decreased amount, abnormal	y1Tg + MO2-vegfc + MO7-sox18	standard conditions	Fig. 5 from Cermenati et al., 2013
posterior cardinal vein vascular sprouts decreased amount, abnormal	y1Tg + MO2-vegfc + MO7-sox18	standard conditions	Fig. 5 from Cermenati et al., 2013
posterior cardinal vein vascular lymphangioblast absent, abnormal	y1Tg + MO2-vegfc + MO7-sox18	standard conditions	Fig. 6 from Cermenati et al., 2013
lymphangiogenesis disrupted, abnormal	hu4624Tg; s916Tg + MO1-vegfc + MO2-vegfc	standard conditions	Fig. 2 from Hogan et al., 2009
angiogenesis disrupted, abnormal	hu4624Tg; s916Tg + MO1-vegfc + MO2-vegfc	standard conditions	Fig. 2 from Hogan et al., 2009

Citations