header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-051207-2
Morpholino Name: MO2-fzd2
Target: fzd2 (1)
Previous Name: fz2 MO-1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCTGCATTGTCTCGAAAAGTTCCGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-fzd2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-fzd2
Expressed Gene Anatomy Figures
myod1 Fig. 2 from Sumanas et al., 2001
tbxta Fig. 2 from Sumanas et al., 2001
PHENOTYPE
Phenotype resulting from MO2-fzd2
Phenotype of all Fish created by or utilizing MO2-fzd2
Phenotype Fish Conditions Figures
notochord undulate, abnormal WT + MO2-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
notochord increased thickness, abnormal WT + MO2-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
somite increased width, abnormal WT + MO2-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
notochord decreased length, abnormal WT + MO2-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
somite condensed, abnormal WT + MO2-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
post-vent region decreased length, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 4 from Oishi et al., 2006
floor plate undulate, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 4 from Oishi et al., 2006
Fig. 2 from Sumanas et al., 2001
post-vent region curved ventral, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 4 from Oishi et al., 2006
post-vent region kinked, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 4 from Oishi et al., 2006
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
endocrine pancreas development disrupted, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 2 with imageFig. 5 with imageFig. 6 with image from Kim et al., 2005
ventral fin fold decreased size, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
cell migration disrupted, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 2 with imageFig. 5 with image from Kim et al., 2005
notochord undulate, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
somite increased width, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
pancreas development disrupted, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 6 with image from Kim et al., 2005
Kupffer's vesicle cilium decreased length, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 4 from Oishi et al., 2006
dorsal fin decreased size, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
whole organism oblong, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
notochord decreased length, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
heart tube inverted, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 4 from Oishi et al., 2006
Kupffer's vesicle cilium decreased amount, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 4 from Oishi et al., 2006
notochord increased width, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
hypochord undulate, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
heart looping disrupted, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 4 from Oishi et al., 2006
convergent extension involved in gastrulation disrupted, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
Fig. 2 from Sumanas et al., 2001
notochord kinked, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
somitogenesis disrupted, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 4 from Oishi et al., 2006
somite asymmetrical, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 4 from Oishi et al., 2006
cell migration disrupted, abnormal zf5Tg + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 1 with image from Kim et al., 2005
endocrine pancreas development disrupted, abnormal zf5Tg + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 1 with image from Kim et al., 2005
convergent extension involved in gastrulation disrupted, abnormal wnt5bta98/ta98 + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
notochord increased width, abnormal wnt5bta98/ta98 + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
notochord decreased length, abnormal wnt5bta98/ta98 + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
notochord increased width, abnormal wnt11tx226/tx226 + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
notochord decreased length, abnormal wnt11tx226/tx226 + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
convergent extension involved in gastrulation disrupted, abnormal wnt11tx226/tx226 + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
notochord decreased length, abnormal WT + MO1-wnt5b + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-wnt5b + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
OTHER MO2-fzd2 MORPHOLINO PAGES
  • MODB:79 (2)
  • MODB:81 (2)
  • MODB:750 (2)
  • CITATIONS (6)