ZFIN ID: ZDB-MRPHLNO-051127-1
Morpholino Name: MO1-rbmx
Target: rbmx (1)
Sequence:
5' - TCCCAGGTCGGTCTGCCTCTGCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-rbmx No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-rbmx
Expressed Gene Anatomy Figures
egr2b Fig. 4 with image from Tsend-Ayush et al., 2005
otx2b Fig. 4 with image from Tsend-Ayush et al., 2005
pax2a Fig. 4 with image from Tsend-Ayush et al., 2005
rbmx Fig. 3 with image from Tsend-Ayush et al., 2005
PHENOTYPE
Phenotype resulting from MO1-rbmx
No data available

Phenotype of all Fish created by or utilizing MO1-rbmx
No data available
OTHER MO1-rbmx MORPHOLINO PAGESNo links to external sites
CITATIONS (1)