header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-051020-1
Morpholino Name: MO1-angptl2b
Target: angptl2b (1)
Previous Names: Angptl2mo (1), MO1-angptl2

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTAGTGAAGGAACATCCATGACCAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets ATG.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-angptl2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-angptl2b
Expressed Gene Anatomy Figures
fli1a Fig. 1Fig. 2 from Kubota et al., 2005
kdrl Fig. 2 from Kubota et al., 2005
myod1 Fig. 2 from Kubota et al., 2005
nkx2.5 Fig. S6 from Kubota et al., 2005
vegfaa Fig. 2 from Kubota et al., 2005
PHENOTYPE
Phenotype resulting from MO1-angptl2b
No data available

Phenotype of all Fish created by or utilizing MO1-angptl2b
No data available
Genome Resources:
CITATIONS (2)