Morpholino

MO1-slit1a

ID
ZDB-MRPHLNO-050923-6
Name
MO1-slit1a
Previous Names
None
Target
Sequence
5' - GACAACATCCTCCTCTCGCAGGCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-slit1a
Expressed Gene Anatomy Figures
dmbx1a Fig. S4 with image from Campbell et al., 2007
fgf8a Fig. S4 with image from Campbell et al., 2007
gfap Fig. 6 with image from Barresi et al., 2005
robo4 Fig. S4 with image from Campbell et al., 2007
tbx5a Fig. S4 with image from Campbell et al., 2007
Phenotype
Phenotype resulting from MO1-slit1a
Phenotype Fish Figures
cranial nerve VIII defasciculated, abnormal zc7Tg + MO1-slit1a + MO4-tp53 Fig. 8 from Zecca et al., 2015
cranial nerve VIII axon mislocalised, abnormal zc7Tg + MO1-slit1a + MO4-tp53 Fig. 8 from Zecca et al., 2015
cranial nerve VIII axon guidance process quality, abnormal zc7Tg + MO1-slit1a + MO4-tp53 Fig. 8 from Zecca et al., 2015
retinal ganglion cell axon physical object quality, abnormal WT + MO1-slit1a Fig. 5 with image from Campbell et al., 2013
retinal ganglion cell cysteine-type endopeptidase activity decreased occurrence, abnormal WT + MO1-slit1a Fig. 5 with image from Campbell et al., 2013
Phenotype of all Fish created by or utilizing MO1-slit1a
Phenotype Fish Conditions Figures
retinal ganglion cell axon physical object quality, abnormal WT + MO1-slit1a standard conditions Fig. 5 with image from Campbell et al., 2013
retinal ganglion cell cysteine-type endopeptidase activity decreased occurrence, abnormal WT + MO1-slit1a standard conditions Fig. 5 with image from Campbell et al., 2013
cranial nerve VIII axon mislocalised, abnormal zc7Tg + MO1-slit1a + MO4-tp53 control Fig. 8 from Zecca et al., 2015
cranial nerve VIII axon guidance process quality, abnormal zc7Tg + MO1-slit1a + MO4-tp53 control Fig. 8 from Zecca et al., 2015
cranial nerve VIII defasciculated, abnormal zc7Tg + MO1-slit1a + MO4-tp53 control Fig. 8 from Zecca et al., 2015
retinal ganglion cell axon has extra parts of type retinal ganglion cell presynaptic active zone, abnormal WT + MO1-casp3a + MO1-slit1a standard conditions Fig. 6 with image from Campbell et al., 2013
retinal ganglion cell axon collateral increased length, abnormal WT + MO1-casp3a + MO1-slit1a standard conditions Fig. 6 with image from Campbell et al., 2013
retinal ganglion cell collateral sprouting in absence of injury occurrence, abnormal WT + MO1-casp3a + MO1-slit1a standard conditions Fig. 8 with image from Campbell et al., 2013
retinal ganglion cell axon collateral physical object quality, abnormal WT + MO1-casp3a + MO1-slit1a standard conditions Fig. 8 with image from Campbell et al., 2013
retinal ganglion cell axon increased branchiness, abnormal WT + MO1-casp3a + MO1-slit1a standard conditions Fig. 6 with image from Campbell et al., 2013
retinal ganglion cell neuron remodeling decreased process quality, abnormal WT + MO1-casp3a + MO1-slit1a standard conditions Fig. 8 with image from Campbell et al., 2013
retinal ganglion cell collateral sprouting in absence of injury increased occurrence, abnormal WT + MO1-casp3a + MO1-slit1a standard conditions Fig. 6 with image from Campbell et al., 2013
retinal ganglion cell axon collateral increased length, abnormal WT + MO1-mapk14a + MO1-slit1a standard conditions Fig. 7 with image from Campbell et al., 2013
retinal ganglion cell axon increased branchiness, abnormal WT + MO1-mapk14a + MO1-slit1a standard conditions Fig. 7 with image from Campbell et al., 2013
retinal ganglion cell collateral sprouting in absence of injury increased occurrence, abnormal WT + MO1-mapk14a + MO1-slit1a standard conditions Fig. 7 with image from Campbell et al., 2013
retinal ganglion cell axon has extra parts of type retinal ganglion cell presynaptic active zone, abnormal WT + MO1-mapk14a + MO1-slit1a standard conditions Fig. 7 with image from Campbell et al., 2013
retinal ganglion cell axon increased branchiness, abnormal WT + MO1-slit1a + MO2-casp9 standard conditions Fig. 6 with image from Campbell et al., 2013
retinal ganglion cell collateral sprouting in absence of injury increased occurrence, abnormal WT + MO1-slit1a + MO2-casp9 standard conditions Fig. 6 with image from Campbell et al., 2013
retinal ganglion cell axon collateral increased length, abnormal WT + MO1-slit1a + MO2-casp9 standard conditions Fig. 6 with image from Campbell et al., 2013
retinal ganglion cell axon has extra parts of type retinal ganglion cell presynaptic active zone, abnormal WT + MO1-slit1a + MO2-casp9 standard conditions Fig. 6 with image from Campbell et al., 2013
cranial nerve VIII axon mislocalised, abnormal zc7Tg + MO1-slit1a + MO1-slit1b + MO4-tp53 control Fig. 8 from Zecca et al., 2015
cranial nerve VIII axon guidance process quality, abnormal zc7Tg + MO1-slit1a + MO1-slit1b + MO4-tp53 control Fig. 8 from Zecca et al., 2015
cranial nerve VIII defasciculated, abnormal zc7Tg + MO1-slit1a + MO1-slit1b + MO4-tp53 control Fig. 8 from Zecca et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.