ZFIN ID: ZDB-MRPHLNO-050914-2
Morpholino Name: MO2-mef2aa
Target: mef2aa (1)
Previous Names: ATG-MO (1), MO2-mef2a

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ATCTGTATCTTCTTCCGTCCCATCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-mef2aa No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-mef2aa
Expressed Gene Anatomy Figures
mef2aa Fig. 2 from Wang et al., 2005
PHENOTYPE
Phenotype resulting from MO2-mef2aa
Phenotype of all Fish created by or utilizing MO2-mef2aa
Genome Resources:
CITATIONS (3)