ZFIN ID: ZDB-MRPHLNO-050818-5
Morpholino Name: MO1-fgf4
Target: fgf4 (1)
Previous Names: E1I1 (1), fgf4-MOE1I1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AACTTACTGTAGCGGTTTTCGTTGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-fgf4 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-fgf4 No data available
PHENOTYPE
Phenotype resulting from MO1-fgf4
No data available

Phenotype of all Fish created by or utilizing MO1-fgf4
No data available
OTHER MO1-fgf4 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)