ZFIN ID: ZDB-MRPHLNO-050817-1
Morpholino Name: MO1-llgl2
Target: llgl2 (1)
Previous Name: lgl2MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCCCATGACGCCTGAACCTCTTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-llgl2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-llgl2
Expressed Gene Anatomy Figures
elovl6 Fig. 7 with image from Ji et al., 2016
spaw Fig. 3 with image from Tay et al., 2013
tp63 Fig. 6 with image from Dodd et al., 2009
PHENOTYPE
Phenotype resulting from MO1-llgl2
Phenotype Figures
brain hydrocephalic, abnormal Fig. 1 with image from Tay et al., 2013
brain elovl6 expression spatial pattern, abnormal Fig. 7 with image from Ji et al., 2016
brain right side elovl6 expression mislocalised, abnormal Fig. 7 with image from Ji et al., 2016
determination of heart left/right asymmetry decreased process quality, abnormal Fig. 3 with image from Tay et al., 2013
determination of left/right asymmetry in nervous system disrupted, abnormal Fig. 7 with image from Ji et al., 2016
heart symmetry, abnormal Fig. 3 with image from Tay et al., 2013
heart looping decreased process quality, abnormal Fig. 3 with image from Tay et al., 2013
Kupffer's vesicle decreased area, abnormal Fig. 2 with image from Tay et al., 2013
Kupffer's vesicle decreased volume, abnormal Fig. 1 with image from Tay et al., 2013
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal Fig. 1 with imageFig. 2 with image from Tay et al., 2013
Kupffer's vesicle basolateral plasma membrane physical object quality, abnormal Fig. 4 with image from Tay et al., 2013
Kupffer's vesicle motile cilium decreased length, abnormal Fig. 1 with imageFig. 2 with image from Tay et al., 2013
Kupffer's vesicle motile cilium assembly decreased process quality, abnormal Fig. 1 with image from Tay et al., 2013
Kupffer's vesicle development decreased process quality, abnormal Fig. 1 with image from Tay et al., 2013
lateral plate mesoderm bilateral symmetry, abnormal Fig. 3 with image from Tay et al., 2013
left/right pattern formation disrupted, abnormal Fig. 7 with image from Ji et al., 2016
otic vesicle decreased volume, abnormal Fig. 1 with image from Tay et al., 2013
otic vesicle has fewer parts of type otic vesicle motile cilium, abnormal Fig. 1 with image from Tay et al., 2013
otic vesicle motile cilium decreased length, abnormal Fig. 1 with image from Tay et al., 2013
otic vesicle motile cilium assembly decreased process quality, abnormal Fig. 1 with image from Tay et al., 2013
post-vent region curved ventral, abnormal Fig. 1 with image from Tay et al., 2013
pronephric duct motile cilium decreased length, abnormal Fig. 1 with image from Tay et al., 2013
pronephric duct motile cilium disorganized, abnormal Fig. 1 with image from Tay et al., 2013
pronephric duct morphogenesis decreased process quality, abnormal Fig. 1 with image from Tay et al., 2013

Phenotype of all Fish created by or utilizing MO1-llgl2
Phenotype Fish Conditions Figures
left/right pattern formation disrupted, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 7 with image from Ji et al., 2016
Kupffer's vesicle development decreased process quality, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
determination of left/right asymmetry in nervous system disrupted, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 7 with image from Ji et al., 2016
Kupffer's vesicle decreased volume, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
otic vesicle has fewer parts of type otic vesicle motile cilium, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
brain right side elovl6 expression mislocalised, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 7 with image from Ji et al., 2016
pronephric duct motile cilium disorganized, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
Kupffer's vesicle motile cilium assembly decreased process quality, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
determination of heart left/right asymmetry decreased process quality, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 3 with image from Tay et al., 2013
pronephric duct morphogenesis decreased process quality, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
Kupffer's vesicle motile cilium decreased length, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
pronephric duct motile cilium decreased length, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
brain hydrocephalic, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
lateral plate mesoderm bilateral symmetry, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 3 with image from Tay et al., 2013
otic vesicle motile cilium decreased length, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
brain elovl6 expression spatial pattern, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 7 with image from Ji et al., 2016
otic vesicle decreased volume, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
post-vent region curved ventral, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
otic vesicle motile cilium assembly decreased process quality, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
Kupffer's vesicle basolateral plasma membrane physical object quality, abnormal pt19Tg + MO1-llgl2 standard conditions Fig. 4 with image from Tay et al., 2013
Kupffer's vesicle motile cilium decreased length, abnormal s870Tg + MO1-llgl2 standard conditions Fig. 2 with image from Tay et al., 2013
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal s870Tg + MO1-llgl2 standard conditions Fig. 2 with image from Tay et al., 2013
Kupffer's vesicle decreased area, abnormal s870Tg + MO1-llgl2 standard conditions Fig. 2 with image from Tay et al., 2013
heart symmetry, abnormal twu34Tg + MO1-llgl2 standard conditions Fig. 3 with image from Tay et al., 2013
heart looping decreased process quality, abnormal twu34Tg + MO1-llgl2 standard conditions Fig. 3 with image from Tay et al., 2013
Kupffer's vesicle anatomical space decreased volume, abnormal sny120Tg ; a131Tg + MO1-llgl2 + MO4-tp53 chemical treatment by environment: afimoxifene Fig. 6 with image from Dasgupta et al., 2018
epidermis malformed, abnormal AB + MO1-llgl2 + MO2-clint1a standard conditions Fig. 6 with image from Dodd et al., 2009
ventral fin fold malformed, abnormal AB + MO1-llgl2 + MO2-clint1a standard conditions Fig. 6 with image from Dodd et al., 2009
epidermal cell aggregated, abnormal WT + MO1-llgl2 + MO2-atp1b1a standard conditions Fig. 7 with image from Hatzold et al., 2016
epidermis morphology, abnormal WT + MO1-llgl2 + MO2-atp1b1a standard conditions Fig. 7 with image from Hatzold et al., 2016
Kupffer's vesicle basolateral plasma membrane physical object quality, abnormal pt19Tg + MO1-llgl2 + MO1-rab11a standard conditions Fig. 6 with image from Tay et al., 2013
Kupffer's vesicle development decreased process quality, abnormal s870Tg + MO1-llgl2 + MO1-rab11a standard conditions Fig. 5 with image from Tay et al., 2013
Kupffer's vesicle decreased volume, abnormal s870Tg + MO1-llgl2 + MO1-rab11a standard conditions Fig. 5 with image from Tay et al., 2013
OTHER MO1-llgl2 MORPHOLINO PAGESNo links to external sites
CITATIONS (9)