Morpholino

MO1-scn8aa

ID

ZDB-MRPHLNO-050812-4

Name

MO1-scn8aa

Previous Names

1.6 MO (1)
Nav1.6a MO (1)

Target

scn8aa (1)

Sequence

5' - GGGTGCAGCCATGTTTTCATCCTGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

targeted to predicted translation start methionine

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-scn8aa

Expressed Gene	Anatomy	Figures
alcama	secondary motor neuron	Fig. 6 , Fig. 7 , Fig. 8 from Pineda et al., 2006
elavl3	Rohon-Beard neuron	Fig. 4 from Pineda et al., 2006

Phenotype

Phenotype resulting from MO1-scn8aa

Phenotype	Fish	Figures
dorsal root ganglion axon collateral mislocalised laterally, abnormal	WT + MO1-scn8aa	Fig. 4 from Wright et al., 2010
dorsal root ganglion neuron mislocalised ventrally, abnormal	WT + MO1-scn8aa	Fig. 2 , Fig. 3 , Fig. 4 from Wright et al., 2010
dorsal root ganglion neuron mobile, abnormal	WT + MO1-scn8aa	Fig. 4 from Wright et al., 2010
dorsal root ganglion neuron neural crest derived mislocalised ventrally, abnormal	sb4Tg + MO1-scn8aa	Fig. 1 from Wright et al., 2010
mechanoreceptor cell voltage-gated sodium channel complex decreased functionality, abnormal	WT + MO1-scn8aa	Fig. 10 from Pineda et al., 2005
neuron differentiation process quality, abnormal	sb4Tg + MO1-scn8aa	Fig. 1 , Fig. 4 from Wright et al., 2010
neuron migration process quality, abnormal	rw0130aTg + MO1-scn8aa	Fig. 2 , Fig. 3 from Wright et al., 2010
Rohon-Beard neuron increased life span, abnormal	WT + MO1-scn8aa	Fig. 4 from Pineda et al., 2006
Rohon-Beard neuron membrane potential, abnormal	WT + MO1-scn8aa	Fig. 10 from Pineda et al., 2005
Rohon-Beard neuron present, abnormal	WT + MO1-scn8aa	Fig. 4 from Pineda et al., 2006
secondary motor neuron axon misrouted, abnormal	WT + MO1-scn8aa	Fig. 5 , Fig. 6 , Fig. 8 from Pineda et al., 2006
sensory perception of touch decreased magnitude, abnormal	WT + MO1-scn8aa	Fig. 6 from Wright et al., 2010
thigmotaxis decreased occurrence, abnormal	WT + MO1-scn8aa	Fig. 7 from Pineda et al., 2005
voltage-gated sodium channel activity amplitude, abnormal	WT + MO1-scn8aa	Fig. 6, Fig. 10 from Pineda et al., 2005
whole organism movement behavioral quality, abnormal	WT + MO1-scn8aa	Fig. 7 from Pineda et al., 2005

Phenotype of all Fish created by or utilizing MO1-scn8aa

Phenotype	Fish	Conditions	Figures
Rohon-Beard neuron present, abnormal	WT + MO1-scn8aa	standard conditions	Fig. 4 from Pineda et al., 2006
voltage-gated sodium channel activity amplitude, abnormal	WT + MO1-scn8aa	standard conditions	Fig. 6, Fig. 10 from Pineda et al., 2005
secondary motor neuron axon misrouted, abnormal	WT + MO1-scn8aa	standard conditions	Fig. 5 , Fig. 6 , Fig. 8 from Pineda et al., 2006
dorsal root ganglion neuron mislocalised ventrally, abnormal	WT + MO1-scn8aa	standard conditions	Fig. 4 from Wright et al., 2010
neuron differentiation process quality, abnormal	WT + MO1-scn8aa	standard conditions	Fig. 4 from Wright et al., 2010
Rohon-Beard neuron membrane potential, abnormal	WT + MO1-scn8aa	standard conditions	Fig. 10 from Pineda et al., 2005
sensory perception of touch decreased magnitude, abnormal	WT + MO1-scn8aa	standard conditions	Fig. 6 from Wright et al., 2010
dorsal root ganglion neuron mobile, abnormal	WT + MO1-scn8aa	standard conditions	Fig. 4 from Wright et al., 2010
dorsal root ganglion axon collateral mislocalised laterally, abnormal	WT + MO1-scn8aa	standard conditions	Fig. 4 from Wright et al., 2010
whole organism movement behavioral quality, abnormal	WT + MO1-scn8aa	standard conditions	Fig. 7 from Pineda et al., 2005
thigmotaxis decreased occurrence, abnormal	WT + MO1-scn8aa	standard conditions	Fig. 7 from Pineda et al., 2005
mechanoreceptor cell voltage-gated sodium channel complex decreased functionality, abnormal	WT + MO1-scn8aa	standard conditions	Fig. 10 from Pineda et al., 2005
Rohon-Beard neuron increased life span, abnormal	WT + MO1-scn8aa	standard conditions	Fig. 4 from Pineda et al., 2006
neuron migration process quality, abnormal	rw0130aTg + MO1-scn8aa	standard conditions	Fig. 3 from Wright et al., 2010
dorsal root ganglion neuron mislocalised ventrally, abnormal	rw0130aTg + MO1-scn8aa	standard conditions	Fig. 3 from Wright et al., 2010
neuron differentiation process quality, abnormal	sb4Tg + MO1-scn8aa	standard conditions	Fig. 1 from Wright et al., 2010
neuron migration process quality, abnormal	sb4Tg + MO1-scn8aa	standard conditions	Fig. 2 from Wright et al., 2010
dorsal root ganglion neuron mislocalised ventrally, abnormal	sb4Tg + MO1-scn8aa	standard conditions	Fig. 2 from Wright et al., 2010
dorsal root ganglion neuron neural crest derived mislocalised ventrally, abnormal	sb4Tg + MO1-scn8aa	standard conditions	Fig. 1 from Wright et al., 2010

Citations