Morpholino

MO1-acvr2aa

ID
ZDB-MRPHLNO-050812-3
Name
MO1-acvr2aa
Previous Names
  • MO1-acvr2a
Target
Sequence
5' - GCAGGTCCCATTTTTTCACTCTTCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-acvr2aa
Phenotype
Phenotype resulting from MO1-acvr2aa
Phenotype Fish Figures
branchiostegal ray 1 aplastic, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
branchiostegal ray 3 decreased size, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
branchiostegal ray 3 shape, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
cartilage development disrupted, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
ceratobranchial 1 cartilage truncated, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
ceratobranchial 2 cartilage aplastic, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
ceratobranchial 3 cartilage aplastic, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
ceratobranchial 4 cartilage aplastic, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
ceratobranchial 5 cartilage truncated, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
ceratobranchial 5 tooth aplastic, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
cranial cartilage aplastic, abnormal WT + MO1-acvr2aa text only from Albertson et al., 2005
dentary decreased size, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
dentary shape, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
endochondral bone aplastic, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
eye mislocalised laterally, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
eye swollen, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
hindbrain apoptotic, abnormal WT + MO1-acvr2aa Fig. 6 with image from Albertson et al., 2005
hyosymplectic cartilage structure, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
mandibular arch skeleton decreased length, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
mandibular arch skeleton disorganized, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
maxilla decreased size, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
maxilla fused with maxilla, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
maxilla shape, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
Meckel's cartilage fused with palatoquadrate cartilage, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
Meckel's cartilage structure, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
midbrain apoptotic, abnormal WT + MO1-acvr2aa Fig. 6 with image from Albertson et al., 2005
opercle decreased size, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
opercle shape, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
palatoquadrate cartilage fused with hyosymplectic cartilage, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
palatoquadrate cartilage structure, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
pharyngeal arch 2 skeleton decreased length, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
pharyngeal arch 2 skeleton disorganized, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
whole organism decreased length, abnormal WT + MO1-acvr2aa Fig. 4 with image from Albertson et al., 2005
whole organism lethal (sensu genetics), abnormal WT + MO1-acvr2aa text only from Albertson et al., 2005
Phenotype of all Fish created by or utilizing MO1-acvr2aa
Phenotype Fish Conditions Figures
branchiostegal ray 1 aplastic, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
palatoquadrate cartilage structure, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
Meckel's cartilage structure, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
palatoquadrate cartilage fused with hyosymplectic cartilage, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
maxilla fused with maxilla, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
branchiostegal ray 3 decreased size, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
ceratobranchial 2 cartilage aplastic, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
mandibular arch skeleton decreased length, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
eye mislocalised laterally, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
branchiostegal ray 3 shape, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
dentary decreased size, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
ceratobranchial 3 cartilage aplastic, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
midbrain apoptotic, abnormal WT + MO1-acvr2aa standard conditions Fig. 6 with image from Albertson et al., 2005
Meckel's cartilage fused with palatoquadrate cartilage, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
pharyngeal arch 2 skeleton decreased length, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
cartilage development disrupted, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
ceratobranchial 1 cartilage truncated, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
pharyngeal arch 2 skeleton disorganized, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
ceratobranchial 5 cartilage truncated, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
whole organism decreased length, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
ceratobranchial 5 tooth aplastic, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
whole organism lethal (sensu genetics), abnormal WT + MO1-acvr2aa standard conditions text only from Albertson et al., 2005
ceratobranchial 4 cartilage aplastic, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
mandibular arch skeleton disorganized, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
opercle decreased size, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
endochondral bone aplastic, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
hyosymplectic cartilage structure, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
opercle shape, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
cranial cartilage aplastic, abnormal WT + MO1-acvr2aa standard conditions text only from Albertson et al., 2005
maxilla decreased size, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
hindbrain apoptotic, abnormal WT + MO1-acvr2aa standard conditions Fig. 6 with image from Albertson et al., 2005
maxilla shape, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
eye swollen, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
dentary shape, abnormal WT + MO1-acvr2aa standard conditions Fig. 4 with image from Albertson et al., 2005
Citations