ZFIN ID: ZDB-MRPHLNO-050812-1
Morpholino Name: MO1-vps18
Target: vps18 (1)
Sequence:
5' - ATTGATCCAGAATAGATGCCATTGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-vps18 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-vps18 No data available
PHENOTYPE
Phenotype resulting from MO1-vps18
Phenotype Figures
liver increased size, abnormal Fig. 5 with image from Sadler et al., 2005
pigmentation disrupted, abnormal Fig. 4 with image from Sadler et al., 2005
whole organism unpigmented, abnormal Fig. 4 with image from Sadler et al., 2005

Phenotype of all Fish created by or utilizing MO1-vps18
Phenotype Fish Conditions Figures
whole organism unpigmented, abnormal WT + MO1-vps18 standard conditions Fig. 4 with image from Sadler et al., 2005
liver increased size, abnormal WT + MO1-vps18 standard conditions Fig. 5 with image from Sadler et al., 2005
pigmentation disrupted, abnormal WT + MO1-vps18 standard conditions Fig. 4 with image from Sadler et al., 2005
OTHER MO1-vps18 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)